Incidental Mutation 'R5327:Dsg1c'
ID422095
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
MMRRC Submission 042910-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5327 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20267937 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 166 (I166V)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054128
AA Change: I166V

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: I166V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Meta Mutation Damage Score 0.1964 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (101/101)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,741,003 S36G probably damaging Het
Aarsd1 T C 11: 101,410,377 N280D probably benign Het
Abca2 T A 2: 25,445,674 M2099K probably damaging Het
Abcb5 T A 12: 118,911,543 E631D probably benign Het
Acss2 T A 2: 155,573,229 L682Q probably null Het
Adamts14 G A 10: 61,198,488 P1207L probably benign Het
Adora1 G A 1: 134,203,010 R308* probably null Het
Arcn1 A T 9: 44,757,147 V264E probably benign Het
B3galt1 G A 2: 68,118,768 G276S probably damaging Het
Bms1 A T 6: 118,405,218 M453K possibly damaging Het
Bnip3l T C 14: 66,987,731 Y218C probably damaging Het
Cacna2d2 A G 9: 107,513,606 E379G probably null Het
Cacng6 G A 7: 3,434,860 G235R probably damaging Het
Capn8 A T 1: 182,628,604 T640S probably benign Het
Ccdc106 T C 7: 5,060,160 probably benign Het
Ccdc33 A T 9: 58,086,577 N95K probably benign Het
Celsr3 T A 9: 108,842,708 probably benign Het
Cemip A T 7: 83,955,301 N844K probably damaging Het
Chrdl2 A T 7: 100,028,741 T284S probably damaging Het
Ckm A G 7: 19,420,165 Y279C probably damaging Het
Clvs1 A T 4: 9,424,261 I236F probably damaging Het
Col9a1 T C 1: 24,195,539 probably null Het
Csmd1 T C 8: 17,216,712 E66G possibly damaging Het
Ctdsp2 A G 10: 126,996,054 D26G probably damaging Het
Ctsll3 C A 13: 60,798,907 probably null Het
Cyp2d12 A T 15: 82,555,222 M26L probably benign Het
Cyp8b1 C T 9: 121,914,884 D461N probably damaging Het
Dbt A T 3: 116,528,571 probably benign Het
Dnah7c A G 1: 46,665,568 D2247G probably benign Het
Duoxa1 T A 2: 122,303,880 E252D probably damaging Het
Ezr T A 17: 6,753,049 K211M probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fahd2a T C 2: 127,441,958 D54G possibly damaging Het
Fbxo9 A T 9: 78,095,864 probably null Het
Fndc1 A G 17: 7,772,708 S719P unknown Het
Gas7 G T 11: 67,662,090 G159C probably damaging Het
Gba2 T C 4: 43,574,063 D130G probably damaging Het
Gli3 T G 13: 15,548,507 S78A probably damaging Het
Gtpbp6 A G 5: 110,106,904 F101S probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Hmbox1 G A 14: 64,896,695 S152L possibly damaging Het
Ibtk A G 9: 85,737,466 probably null Het
Jade1 T C 3: 41,613,978 I827T possibly damaging Het
Jakmip3 A T 7: 139,025,435 E389D possibly damaging Het
Klhdc8b A T 9: 108,449,042 probably benign Het
Lama2 T C 10: 27,138,946 T1589A probably benign Het
Lbx2 A C 6: 83,087,803 K107T probably damaging Het
Ldha A G 7: 46,854,098 M259V probably benign Het
Lrrtm4 A G 6: 80,022,637 K344R probably damaging Het
Ltb A T 17: 35,195,959 E245V probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Map3k13 T A 16: 21,921,647 S575T possibly damaging Het
Mcpt2 A T 14: 56,043,376 I74F probably damaging Het
Mpeg1 T A 19: 12,461,649 V157D probably damaging Het
Mrpl21 A T 19: 3,287,009 probably null Het
Nagpa T C 16: 5,200,013 T99A possibly damaging Het
Nphs1 A T 7: 30,463,825 I469F probably benign Het
Nyap2 A G 1: 81,192,041 E171G possibly damaging Het
Oas1e A G 5: 120,791,941 Y171H probably damaging Het
Olfr1129 T A 2: 87,575,699 V205D probably damaging Het
Olfr1392 T C 11: 49,293,666 L115P probably damaging Het
Olfr196 T C 16: 59,167,620 I174M possibly damaging Het
Olfr205 T C 16: 59,329,098 K137R probably benign Het
Otud7b C A 3: 96,155,738 Q765K probably benign Het
Pdzd7 A G 19: 45,028,777 V851A probably benign Het
Pi4ka T G 16: 17,325,413 K794T probably damaging Het
Pkhd1l1 T A 15: 44,546,862 N2588K probably damaging Het
Pla2g6 A T 15: 79,302,637 M471K probably benign Het
Plagl2 T C 2: 153,235,839 H74R possibly damaging Het
Prf1 T A 10: 61,300,258 N104K probably benign Het
Ptprf A T 4: 118,236,389 I358N probably damaging Het
Rcsd1 A G 1: 165,655,303 probably null Het
Rev1 G A 1: 38,108,451 R3* probably null Het
Rp1 T C 1: 4,349,360 probably null Het
Rrp12 G A 19: 41,892,596 T132I probably damaging Het
Sema3a T C 5: 13,599,389 V702A probably benign Het
Serpinb12 A G 1: 106,956,444 N307D probably damaging Het
Slc35d1 A G 4: 103,213,186 L103P probably damaging Het
Smyd4 T C 11: 75,390,939 C413R probably damaging Het
Stab1 G A 14: 31,161,836 Q255* probably null Het
Synpo T A 18: 60,603,846 I343F possibly damaging Het
Tcirg1 A G 19: 3,902,342 probably null Het
Tmem132c A G 5: 127,563,752 T996A possibly damaging Het
Trim10 A G 17: 36,870,189 E104G probably damaging Het
Trpc1 T C 9: 95,721,471 probably null Het
Tspo2 A T 17: 48,449,859 probably benign Het
Ugt2a3 A T 5: 87,331,315 I258N probably damaging Het
Usp34 T C 11: 23,468,846 L2998P probably damaging Het
Vmn1r45 A C 6: 89,933,141 D162E possibly damaging Het
Vmn2r117 A T 17: 23,477,874 Y186* probably null Het
Vmn2r67 A G 7: 85,136,490 F769S probably damaging Het
Zbtb17 A G 4: 141,465,631 I514V probably benign Het
Zfp329 A C 7: 12,811,494 D34E probably benign Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
R8048:Dsg1c UTSW 18 20274767 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Z1176:Dsg1c UTSW 18 20283573 missense probably damaging 1.00
Z1177:Dsg1c UTSW 18 20264949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTACCAAGGGAATGCCTC -3'
(R):5'- CGAGGCATGATTATCAATCCCAC -3'

Sequencing Primer
(F):5'- GGTACCAAGGGAATGCCTCTATTC -3'
(R):5'- TCCTGGGCTGACACTGCAAC -3'
Posted On2016-08-04