Incidental Mutation 'R5327:Mpeg1'
ID422099
Institutional Source Beutler Lab
Gene Symbol Mpeg1
Ensembl Gene ENSMUSG00000046805
Gene Namemacrophage expressed gene 1
SynonymsMPS1, Mpg-1
MMRRC Submission 042910-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5327 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12460779-12465284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12461649 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 157 (V157D)
Ref Sequence ENSEMBL: ENSMUSP00000108573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521] [ENSMUST00000081035]
Predicted Effect probably benign
Transcript: ENSMUST00000045521
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000081035
AA Change: V157D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108573
Gene: ENSMUSG00000046805
AA Change: V157D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MACPF 151 350 2.13e-58 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 685 698 N/A INTRINSIC
Meta Mutation Damage Score 0.9071 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (101/101)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,741,003 S36G probably damaging Het
Aarsd1 T C 11: 101,410,377 N280D probably benign Het
Abca2 T A 2: 25,445,674 M2099K probably damaging Het
Abcb5 T A 12: 118,911,543 E631D probably benign Het
Acss2 T A 2: 155,573,229 L682Q probably null Het
Adamts14 G A 10: 61,198,488 P1207L probably benign Het
Adora1 G A 1: 134,203,010 R308* probably null Het
Arcn1 A T 9: 44,757,147 V264E probably benign Het
B3galt1 G A 2: 68,118,768 G276S probably damaging Het
Bms1 A T 6: 118,405,218 M453K possibly damaging Het
Bnip3l T C 14: 66,987,731 Y218C probably damaging Het
Cacna2d2 A G 9: 107,513,606 E379G probably null Het
Cacng6 G A 7: 3,434,860 G235R probably damaging Het
Capn8 A T 1: 182,628,604 T640S probably benign Het
Ccdc106 T C 7: 5,060,160 probably benign Het
Ccdc33 A T 9: 58,086,577 N95K probably benign Het
Celsr3 T A 9: 108,842,708 probably benign Het
Cemip A T 7: 83,955,301 N844K probably damaging Het
Chrdl2 A T 7: 100,028,741 T284S probably damaging Het
Ckm A G 7: 19,420,165 Y279C probably damaging Het
Clvs1 A T 4: 9,424,261 I236F probably damaging Het
Col9a1 T C 1: 24,195,539 probably null Het
Csmd1 T C 8: 17,216,712 E66G possibly damaging Het
Ctdsp2 A G 10: 126,996,054 D26G probably damaging Het
Ctsll3 C A 13: 60,798,907 probably null Het
Cyp2d12 A T 15: 82,555,222 M26L probably benign Het
Cyp8b1 C T 9: 121,914,884 D461N probably damaging Het
Dbt A T 3: 116,528,571 probably benign Het
Dnah7c A G 1: 46,665,568 D2247G probably benign Het
Dsg1c A G 18: 20,267,937 I166V possibly damaging Het
Duoxa1 T A 2: 122,303,880 E252D probably damaging Het
Ezr T A 17: 6,753,049 K211M probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fahd2a T C 2: 127,441,958 D54G possibly damaging Het
Fbxo9 A T 9: 78,095,864 probably null Het
Fndc1 A G 17: 7,772,708 S719P unknown Het
Gas7 G T 11: 67,662,090 G159C probably damaging Het
Gba2 T C 4: 43,574,063 D130G probably damaging Het
Gli3 T G 13: 15,548,507 S78A probably damaging Het
Gtpbp6 A G 5: 110,106,904 F101S probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Hira T C 16: 18,954,758 Y943H probably damaging Het
Hmbox1 G A 14: 64,896,695 S152L possibly damaging Het
Ibtk A G 9: 85,737,466 probably null Het
Jade1 T C 3: 41,613,978 I827T possibly damaging Het
Jakmip3 A T 7: 139,025,435 E389D possibly damaging Het
Klhdc8b A T 9: 108,449,042 probably benign Het
Lama2 T C 10: 27,138,946 T1589A probably benign Het
Lbx2 A C 6: 83,087,803 K107T probably damaging Het
Ldha A G 7: 46,854,098 M259V probably benign Het
Lrrtm4 A G 6: 80,022,637 K344R probably damaging Het
Ltb A T 17: 35,195,959 E245V probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Map3k13 T A 16: 21,921,647 S575T possibly damaging Het
Mcpt2 A T 14: 56,043,376 I74F probably damaging Het
Mrpl21 A T 19: 3,287,009 probably null Het
Nagpa T C 16: 5,200,013 T99A possibly damaging Het
Nphs1 A T 7: 30,463,825 I469F probably benign Het
Nyap2 A G 1: 81,192,041 E171G possibly damaging Het
Oas1e A G 5: 120,791,941 Y171H probably damaging Het
Olfr1129 T A 2: 87,575,699 V205D probably damaging Het
Olfr1392 T C 11: 49,293,666 L115P probably damaging Het
Olfr196 T C 16: 59,167,620 I174M possibly damaging Het
Olfr205 T C 16: 59,329,098 K137R probably benign Het
Otud7b C A 3: 96,155,738 Q765K probably benign Het
Pdzd7 A G 19: 45,028,777 V851A probably benign Het
Pi4ka T G 16: 17,325,413 K794T probably damaging Het
Pkhd1l1 T A 15: 44,546,862 N2588K probably damaging Het
Pla2g6 A T 15: 79,302,637 M471K probably benign Het
Plagl2 T C 2: 153,235,839 H74R possibly damaging Het
Prf1 T A 10: 61,300,258 N104K probably benign Het
Ptprf A T 4: 118,236,389 I358N probably damaging Het
Rcsd1 A G 1: 165,655,303 probably null Het
Rev1 G A 1: 38,108,451 R3* probably null Het
Rp1 T C 1: 4,349,360 probably null Het
Rrp12 G A 19: 41,892,596 T132I probably damaging Het
Sema3a T C 5: 13,599,389 V702A probably benign Het
Serpinb12 A G 1: 106,956,444 N307D probably damaging Het
Slc35d1 A G 4: 103,213,186 L103P probably damaging Het
Smyd4 T C 11: 75,390,939 C413R probably damaging Het
Stab1 G A 14: 31,161,836 Q255* probably null Het
Synpo T A 18: 60,603,846 I343F possibly damaging Het
Tcirg1 A G 19: 3,902,342 probably null Het
Tmem132c A G 5: 127,563,752 T996A possibly damaging Het
Trim10 A G 17: 36,870,189 E104G probably damaging Het
Trpc1 T C 9: 95,721,471 probably null Het
Tspo2 A T 17: 48,449,859 probably benign Het
Ugt2a3 A T 5: 87,331,315 I258N probably damaging Het
Usp34 T C 11: 23,468,846 L2998P probably damaging Het
Vmn1r45 A C 6: 89,933,141 D162E possibly damaging Het
Vmn2r117 A T 17: 23,477,874 Y186* probably null Het
Vmn2r67 A G 7: 85,136,490 F769S probably damaging Het
Zbtb17 A G 4: 141,465,631 I514V probably benign Het
Zfp329 A C 7: 12,811,494 D34E probably benign Het
Other mutations in Mpeg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mpeg1 APN 19 12462710 missense probably benign 0.39
IGL00902:Mpeg1 APN 19 12461769 missense probably damaging 1.00
IGL01141:Mpeg1 APN 19 12462785 missense probably damaging 1.00
IGL02037:Mpeg1 APN 19 12463296 missense probably benign 0.04
IGL02447:Mpeg1 APN 19 12462792 missense probably damaging 1.00
IGL02448:Mpeg1 APN 19 12462609 missense probably benign
IGL02510:Mpeg1 APN 19 12461424 missense probably damaging 1.00
IGL03068:Mpeg1 APN 19 12462206 missense probably benign 0.01
R0128:Mpeg1 UTSW 19 12461223 missense probably benign 0.00
R0310:Mpeg1 UTSW 19 12461691 missense probably benign 0.00
R0312:Mpeg1 UTSW 19 12462403 missense probably damaging 1.00
R0522:Mpeg1 UTSW 19 12461759 missense probably damaging 0.99
R1356:Mpeg1 UTSW 19 12461325 missense probably damaging 0.98
R1396:Mpeg1 UTSW 19 12462804 missense probably damaging 1.00
R1436:Mpeg1 UTSW 19 12462459 missense probably damaging 0.98
R1497:Mpeg1 UTSW 19 12461247 missense probably benign 0.04
R1714:Mpeg1 UTSW 19 12462834 missense probably damaging 1.00
R1846:Mpeg1 UTSW 19 12463122 missense probably benign 0.00
R1856:Mpeg1 UTSW 19 12462356 missense probably benign 0.04
R1933:Mpeg1 UTSW 19 12462647 nonsense probably null
R1959:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R1960:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R1961:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R2240:Mpeg1 UTSW 19 12463038 missense probably damaging 0.98
R2474:Mpeg1 UTSW 19 12462249 missense probably damaging 1.00
R3430:Mpeg1 UTSW 19 12463128 missense probably benign 0.22
R4079:Mpeg1 UTSW 19 12462270 missense probably damaging 0.99
R4245:Mpeg1 UTSW 19 12462908 missense probably damaging 0.99
R4451:Mpeg1 UTSW 19 12463232 nonsense probably null
R4888:Mpeg1 UTSW 19 12463070 missense probably damaging 1.00
R4980:Mpeg1 UTSW 19 12461540 missense probably damaging 1.00
R5071:Mpeg1 UTSW 19 12461181 start codon destroyed probably null 0.02
R5089:Mpeg1 UTSW 19 12462997 missense probably benign 0.00
R5120:Mpeg1 UTSW 19 12461429 nonsense probably null
R5490:Mpeg1 UTSW 19 12461693 missense probably damaging 0.99
R5725:Mpeg1 UTSW 19 12462636 missense probably benign 0.13
R6147:Mpeg1 UTSW 19 12462894 missense probably damaging 1.00
R6243:Mpeg1 UTSW 19 12462240 missense probably benign 0.26
R6486:Mpeg1 UTSW 19 12462105 missense probably damaging 1.00
R6520:Mpeg1 UTSW 19 12461958 missense probably benign 0.04
R7139:Mpeg1 UTSW 19 12461714 missense probably benign 0.07
R7204:Mpeg1 UTSW 19 12462894 missense probably damaging 1.00
R7310:Mpeg1 UTSW 19 12462251 missense probably damaging 0.99
R7665:Mpeg1 UTSW 19 12463094 missense probably damaging 1.00
R7674:Mpeg1 UTSW 19 12461387 missense probably benign
X0064:Mpeg1 UTSW 19 12461972 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGGGCAGTACATCATCCCC -3'
(R):5'- CTAGTGATTACGTGTGTGCCATAG -3'

Sequencing Primer
(F):5'- TCATCCCCGATGAAGTGTATAC -3'
(R):5'- TAGTTGAGGATCAAGAGCTCTGCC -3'
Posted On2016-08-04