Incidental Mutation 'R5328:Gm19965'
ID 422105
Institutional Source Beutler Lab
Gene Symbol Gm19965
Ensembl Gene ENSMUSG00000094429
Gene Name predicted gene, 19965
Synonyms
MMRRC Submission 042843-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R5328 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 116730713-116751140 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116749148 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 276 (H276Q)
Ref Sequence ENSEMBL: ENSMUSP00000137019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179777]
AlphaFold J3QNY8
Predicted Effect possibly damaging
Transcript: ENSMUST00000179777
AA Change: H276Q

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137019
Gene: ENSMUSG00000094429
AA Change: H276Q

DomainStartEndE-ValueType
KRAB 8 68 1.5e-36 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,887,694 (GRCm39) V860E possibly damaging Het
Abcc6 T C 7: 45,641,735 (GRCm39) D881G probably benign Het
Abcc9 A G 6: 142,627,785 (GRCm39) V415A probably benign Het
Adgrb3 A C 1: 25,133,356 (GRCm39) N1003K possibly damaging Het
Adora3 C T 3: 105,814,619 (GRCm39) T123I probably benign Het
Amotl2 A C 9: 102,600,967 (GRCm39) T345P probably benign Het
Arap3 C T 18: 38,124,740 (GRCm39) E247K possibly damaging Het
Atp8b1 A T 18: 64,664,462 (GRCm39) D1235E probably benign Het
Axl A T 7: 25,472,836 (GRCm39) V400E probably damaging Het
Brd8 T A 18: 34,741,034 (GRCm39) N431Y probably benign Het
Cadps A T 14: 12,457,790 (GRCm38) N1025K probably benign Het
Cblc A T 7: 19,526,505 (GRCm39) S195T possibly damaging Het
Chd2 C T 7: 73,113,429 (GRCm39) A1184T possibly damaging Het
Chst10 G A 1: 38,935,043 (GRCm39) probably benign Het
Col12a1 T C 9: 79,527,342 (GRCm39) K2663E probably damaging Het
Cspg4 A T 9: 56,793,140 (GRCm39) I292L probably benign Het
Cul1 T C 6: 47,485,251 (GRCm39) V294A probably damaging Het
Cyp2d11 G A 15: 82,275,972 (GRCm39) P203L probably benign Het
Dnaaf10 C A 11: 17,172,220 (GRCm39) P103Q probably damaging Het
Dscam T C 16: 96,474,878 (GRCm39) H1228R probably benign Het
Eif3l A T 15: 78,977,561 (GRCm39) K534* probably null Het
Enpep T C 3: 129,074,159 (GRCm39) E796G probably benign Het
Ext1 C A 15: 52,939,213 (GRCm39) W612L probably damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fam117a T A 11: 95,254,996 (GRCm39) probably null Het
Fan1 A T 7: 64,004,217 (GRCm39) Y750N probably damaging Het
Fat4 T A 3: 39,011,017 (GRCm39) I2039N probably damaging Het
Gabrr2 G T 4: 33,082,565 (GRCm39) D106Y probably damaging Het
Gak A C 5: 108,764,867 (GRCm39) C145G possibly damaging Het
Galnt14 A T 17: 73,812,454 (GRCm39) N406K possibly damaging Het
Gm10439 T G X: 148,419,159 (GRCm39) *434E probably null Het
Gm10837 G T 14: 122,728,190 (GRCm39) R22L unknown Het
Gm43517 T C 12: 49,437,939 (GRCm39) probably benign Het
Greb1l A T 18: 10,553,720 (GRCm39) I1574F probably damaging Het
Gzme G A 14: 56,355,224 (GRCm39) H236Y probably benign Het
Heatr5b G A 17: 79,133,791 (GRCm39) T266I possibly damaging Het
Hk3 T C 13: 55,161,306 (GRCm39) I185V probably benign Het
Hnrnpr A G 4: 136,066,527 (GRCm39) E302G probably benign Het
Itgal T C 7: 126,910,847 (GRCm39) probably null Het
Itk A G 11: 46,222,703 (GRCm39) S583P probably benign Het
Loxhd1 A T 18: 77,498,268 (GRCm39) I1448F probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,244,784 (GRCm39) probably null Het
Man2a2 A T 7: 80,018,504 (GRCm39) F118L probably benign Het
Mfsd5 T A 15: 102,189,447 (GRCm39) V273E probably damaging Het
Nfe2l2 A G 2: 75,507,200 (GRCm39) L300P probably damaging Het
Nt5c1a T G 4: 123,102,786 (GRCm39) L122R possibly damaging Het
Nt5c3b A G 11: 100,331,067 (GRCm39) F42S probably damaging Het
Or2av9 C A 11: 58,381,255 (GRCm39) A109S possibly damaging Het
Or51g2 T A 7: 102,623,175 (GRCm39) N8I possibly damaging Het
Pabpc1 A T 15: 36,603,121 (GRCm39) D204E probably benign Het
Panx2 A G 15: 88,952,298 (GRCm39) N255S probably damaging Het
Pcnt A G 10: 76,247,553 (GRCm39) L993P probably damaging Het
Pfas A T 11: 68,879,418 (GRCm39) C1160S probably damaging Het
Plekhh3 T A 11: 101,058,484 (GRCm39) probably benign Het
Plod3 T A 5: 137,018,537 (GRCm39) N258K probably damaging Het
Prr14l T C 5: 32,987,365 (GRCm39) Q710R probably benign Het
Rnf216 G T 5: 143,078,754 (GRCm39) T65K possibly damaging Het
Samd9l T C 6: 3,376,739 (GRCm39) E174G probably damaging Het
Septin12 T A 16: 4,811,857 (GRCm39) M63L possibly damaging Het
Sh3bgrl2 T A 9: 83,459,509 (GRCm39) D22E probably benign Het
Sirpd T C 3: 15,397,234 (GRCm39) M17V unknown Het
Skil A G 3: 31,171,718 (GRCm39) K488R probably benign Het
Slamf6 T A 1: 171,765,662 (GRCm39) I262K probably benign Het
Slc27a3 T C 3: 90,294,139 (GRCm39) D470G probably damaging Het
Sorbs3 A T 14: 70,418,623 (GRCm39) V680E probably damaging Het
Sox9 C T 11: 112,673,484 (GRCm39) T25I probably benign Het
Srsf1 G T 11: 87,940,819 (GRCm39) probably benign Het
Stard9 A C 2: 120,529,711 (GRCm39) E1989D probably damaging Het
Thumpd2 T A 17: 81,351,591 (GRCm39) I277F possibly damaging Het
Tinag C A 9: 76,912,913 (GRCm39) G299* probably null Het
Tk2 A T 8: 104,955,931 (GRCm39) probably null Het
Tmem44 A G 16: 30,359,709 (GRCm39) S210P possibly damaging Het
Traf3ip1 C A 1: 91,447,791 (GRCm39) P423T probably damaging Het
Trmt12 A G 15: 58,744,704 (GRCm39) D34G probably damaging Het
Ttc39b A G 4: 83,180,178 (GRCm39) Y72H probably damaging Het
Ttn G A 2: 76,708,755 (GRCm39) probably benign Het
Ttyh2 T A 11: 114,600,894 (GRCm39) I381N possibly damaging Het
Uaca A T 9: 60,777,814 (GRCm39) N734Y probably benign Het
Usp34 T C 11: 23,414,616 (GRCm39) I2853T probably benign Het
Usp34 G A 11: 23,438,659 (GRCm39) G3407D probably benign Het
Vmn2r78 A G 7: 86,570,238 (GRCm39) Y252C probably damaging Het
Wdr19 G A 5: 65,401,522 (GRCm39) C979Y probably damaging Het
Yeats2 A T 16: 19,989,955 (GRCm39) H277L probably damaging Het
Zbtb2 T C 10: 4,319,267 (GRCm39) Y253C possibly damaging Het
Zfat C A 15: 68,051,677 (GRCm39) G706C probably damaging Het
Zfp106 A T 2: 120,350,898 (GRCm39) N1584K possibly damaging Het
Other mutations in Gm19965
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0993:Gm19965 UTSW 1 116,749,555 (GRCm39) missense probably benign 0.04
R1016:Gm19965 UTSW 1 116,749,031 (GRCm39) nonsense probably null
R1173:Gm19965 UTSW 1 116,748,550 (GRCm39) splice site probably benign
R1175:Gm19965 UTSW 1 116,748,550 (GRCm39) splice site probably benign
R1335:Gm19965 UTSW 1 116,732,349 (GRCm39) missense possibly damaging 0.79
R1773:Gm19965 UTSW 1 116,748,989 (GRCm39) nonsense probably null
R1802:Gm19965 UTSW 1 116,748,633 (GRCm39) nonsense probably null
R2884:Gm19965 UTSW 1 116,749,313 (GRCm39) missense probably benign 0.14
R3435:Gm19965 UTSW 1 116,749,353 (GRCm39) missense possibly damaging 0.78
R4072:Gm19965 UTSW 1 116,748,801 (GRCm39) missense probably benign 0.17
R4585:Gm19965 UTSW 1 116,749,508 (GRCm39) missense probably benign 0.00
R4801:Gm19965 UTSW 1 116,749,626 (GRCm39) missense probably benign
R4802:Gm19965 UTSW 1 116,749,626 (GRCm39) missense probably benign
R5856:Gm19965 UTSW 1 116,749,579 (GRCm39) missense probably benign
R5960:Gm19965 UTSW 1 116,749,201 (GRCm39) missense possibly damaging 0.67
R6185:Gm19965 UTSW 1 116,749,003 (GRCm39) missense possibly damaging 0.61
R6297:Gm19965 UTSW 1 116,750,410 (GRCm39) missense possibly damaging 0.82
R6374:Gm19965 UTSW 1 116,750,021 (GRCm39) missense probably benign 0.06
R6811:Gm19965 UTSW 1 116,731,809 (GRCm39) missense probably damaging 1.00
R6860:Gm19965 UTSW 1 116,748,609 (GRCm39) missense probably benign 0.19
R7076:Gm19965 UTSW 1 116,749,005 (GRCm39) missense
R7162:Gm19965 UTSW 1 116,750,095 (GRCm39) missense unknown
R7290:Gm19965 UTSW 1 116,748,921 (GRCm39) missense
R7473:Gm19965 UTSW 1 116,749,602 (GRCm39) missense unknown
R7643:Gm19965 UTSW 1 116,749,959 (GRCm39) missense unknown
R7919:Gm19965 UTSW 1 116,749,850 (GRCm39) nonsense probably null
R8187:Gm19965 UTSW 1 116,749,532 (GRCm39) nonsense probably null
R8306:Gm19965 UTSW 1 116,749,515 (GRCm39) missense
R8477:Gm19965 UTSW 1 116,730,854 (GRCm39) start gained probably benign
R8751:Gm19965 UTSW 1 116,749,867 (GRCm39) missense unknown
R8876:Gm19965 UTSW 1 116,749,776 (GRCm39) missense unknown
R9151:Gm19965 UTSW 1 116,748,942 (GRCm39) missense
R9389:Gm19965 UTSW 1 116,749,566 (GRCm39) missense
R9444:Gm19965 UTSW 1 116,732,393 (GRCm39) missense
R9696:Gm19965 UTSW 1 116,749,210 (GRCm39) missense
R9696:Gm19965 UTSW 1 116,730,838 (GRCm39) start gained probably benign
Z1088:Gm19965 UTSW 1 116,732,330 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGCTTCAGTGCTGTATGAACAAATG -3'
(R):5'- GCTGTTGCAAAGAAGACTGG -3'

Sequencing Primer
(F):5'- TGCTGTATGAACAAATGAGAGAGTG -3'
(R):5'- ACAGTGATTAGAGATAGCCATTTTTC -3'
Posted On 2016-08-04