Incidental Mutation 'R5328:Wdr19'
ID 422128
Institutional Source Beutler Lab
Gene Symbol Wdr19
Ensembl Gene ENSMUSG00000037890
Gene Name WD repeat domain 19
Synonyms D330023L08Rik, DYF2, C330027H04Rik, Ift144
MMRRC Submission 042843-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5328 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 65357039-65417758 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 65401522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 979 (C979Y)
Ref Sequence ENSEMBL: ENSMUSP00000144866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041892] [ENSMUST00000203653]
AlphaFold Q3UGF1
Predicted Effect probably damaging
Transcript: ENSMUST00000041892
AA Change: C979Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038098
Gene: ENSMUSG00000037890
AA Change: C979Y

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203359
Predicted Effect probably damaging
Transcript: ENSMUST00000203653
AA Change: C979Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144866
Gene: ENSMUSG00000037890
AA Change: C979Y

DomainStartEndE-ValueType
WD40 6 42 4.26e1 SMART
WD40 44 83 2.13e1 SMART
WD40 85 125 2.75e1 SMART
WD40 128 166 2.67e-1 SMART
Blast:WD40 220 258 6e-9 BLAST
WD40 264 302 1.46e-1 SMART
Blast:WD40 308 347 2e-18 BLAST
Pfam:WD40_3 508 564 2.7e-32 PFAM
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1259 1268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204647
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD (tryptophan-aspartic acid) repeat family, which is a large family of structurally-related proteins known to participate in a wide range of cellular processes. Each WD repeat typically contains about 40 amino acids that are usually bracketed by glycine-histidine and tryptophan-aspartic acid (WD) dipeptides. This protein contains six WD repeats, three transmembrane domains, and a clathrin heavy-chain repeat. Mutations in this gene have been described in individuals with a wide range of disorders affecting function of the cilium. These disorders are known as ciliopathies, and include Jeune syndrome, Sensenbrenner syndromes, Senior-Loken syndrome, combined or isolated nephronophthisis (NPHP), and retinitis pigmentosa (RP). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,887,694 (GRCm39) V860E possibly damaging Het
Abcc6 T C 7: 45,641,735 (GRCm39) D881G probably benign Het
Abcc9 A G 6: 142,627,785 (GRCm39) V415A probably benign Het
Adgrb3 A C 1: 25,133,356 (GRCm39) N1003K possibly damaging Het
Adora3 C T 3: 105,814,619 (GRCm39) T123I probably benign Het
Amotl2 A C 9: 102,600,967 (GRCm39) T345P probably benign Het
Arap3 C T 18: 38,124,740 (GRCm39) E247K possibly damaging Het
Atp8b1 A T 18: 64,664,462 (GRCm39) D1235E probably benign Het
Axl A T 7: 25,472,836 (GRCm39) V400E probably damaging Het
Brd8 T A 18: 34,741,034 (GRCm39) N431Y probably benign Het
Cadps A T 14: 12,457,790 (GRCm38) N1025K probably benign Het
Cblc A T 7: 19,526,505 (GRCm39) S195T possibly damaging Het
Chd2 C T 7: 73,113,429 (GRCm39) A1184T possibly damaging Het
Chst10 G A 1: 38,935,043 (GRCm39) probably benign Het
Col12a1 T C 9: 79,527,342 (GRCm39) K2663E probably damaging Het
Cspg4 A T 9: 56,793,140 (GRCm39) I292L probably benign Het
Cul1 T C 6: 47,485,251 (GRCm39) V294A probably damaging Het
Cyp2d11 G A 15: 82,275,972 (GRCm39) P203L probably benign Het
Dnaaf10 C A 11: 17,172,220 (GRCm39) P103Q probably damaging Het
Dscam T C 16: 96,474,878 (GRCm39) H1228R probably benign Het
Eif3l A T 15: 78,977,561 (GRCm39) K534* probably null Het
Enpep T C 3: 129,074,159 (GRCm39) E796G probably benign Het
Ext1 C A 15: 52,939,213 (GRCm39) W612L probably damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fam117a T A 11: 95,254,996 (GRCm39) probably null Het
Fan1 A T 7: 64,004,217 (GRCm39) Y750N probably damaging Het
Fat4 T A 3: 39,011,017 (GRCm39) I2039N probably damaging Het
Gabrr2 G T 4: 33,082,565 (GRCm39) D106Y probably damaging Het
Gak A C 5: 108,764,867 (GRCm39) C145G possibly damaging Het
Galnt14 A T 17: 73,812,454 (GRCm39) N406K possibly damaging Het
Gm10439 T G X: 148,419,159 (GRCm39) *434E probably null Het
Gm10837 G T 14: 122,728,190 (GRCm39) R22L unknown Het
Gm19965 T A 1: 116,749,148 (GRCm39) H276Q possibly damaging Het
Gm43517 T C 12: 49,437,939 (GRCm39) probably benign Het
Greb1l A T 18: 10,553,720 (GRCm39) I1574F probably damaging Het
Gzme G A 14: 56,355,224 (GRCm39) H236Y probably benign Het
Heatr5b G A 17: 79,133,791 (GRCm39) T266I possibly damaging Het
Hk3 T C 13: 55,161,306 (GRCm39) I185V probably benign Het
Hnrnpr A G 4: 136,066,527 (GRCm39) E302G probably benign Het
Itgal T C 7: 126,910,847 (GRCm39) probably null Het
Itk A G 11: 46,222,703 (GRCm39) S583P probably benign Het
Loxhd1 A T 18: 77,498,268 (GRCm39) I1448F probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,244,784 (GRCm39) probably null Het
Man2a2 A T 7: 80,018,504 (GRCm39) F118L probably benign Het
Mfsd5 T A 15: 102,189,447 (GRCm39) V273E probably damaging Het
Nfe2l2 A G 2: 75,507,200 (GRCm39) L300P probably damaging Het
Nt5c1a T G 4: 123,102,786 (GRCm39) L122R possibly damaging Het
Nt5c3b A G 11: 100,331,067 (GRCm39) F42S probably damaging Het
Or2av9 C A 11: 58,381,255 (GRCm39) A109S possibly damaging Het
Or51g2 T A 7: 102,623,175 (GRCm39) N8I possibly damaging Het
Pabpc1 A T 15: 36,603,121 (GRCm39) D204E probably benign Het
Panx2 A G 15: 88,952,298 (GRCm39) N255S probably damaging Het
Pcnt A G 10: 76,247,553 (GRCm39) L993P probably damaging Het
Pfas A T 11: 68,879,418 (GRCm39) C1160S probably damaging Het
Plekhh3 T A 11: 101,058,484 (GRCm39) probably benign Het
Plod3 T A 5: 137,018,537 (GRCm39) N258K probably damaging Het
Prr14l T C 5: 32,987,365 (GRCm39) Q710R probably benign Het
Rnf216 G T 5: 143,078,754 (GRCm39) T65K possibly damaging Het
Samd9l T C 6: 3,376,739 (GRCm39) E174G probably damaging Het
Septin12 T A 16: 4,811,857 (GRCm39) M63L possibly damaging Het
Sh3bgrl2 T A 9: 83,459,509 (GRCm39) D22E probably benign Het
Sirpd T C 3: 15,397,234 (GRCm39) M17V unknown Het
Skil A G 3: 31,171,718 (GRCm39) K488R probably benign Het
Slamf6 T A 1: 171,765,662 (GRCm39) I262K probably benign Het
Slc27a3 T C 3: 90,294,139 (GRCm39) D470G probably damaging Het
Sorbs3 A T 14: 70,418,623 (GRCm39) V680E probably damaging Het
Sox9 C T 11: 112,673,484 (GRCm39) T25I probably benign Het
Srsf1 G T 11: 87,940,819 (GRCm39) probably benign Het
Stard9 A C 2: 120,529,711 (GRCm39) E1989D probably damaging Het
Thumpd2 T A 17: 81,351,591 (GRCm39) I277F possibly damaging Het
Tinag C A 9: 76,912,913 (GRCm39) G299* probably null Het
Tk2 A T 8: 104,955,931 (GRCm39) probably null Het
Tmem44 A G 16: 30,359,709 (GRCm39) S210P possibly damaging Het
Traf3ip1 C A 1: 91,447,791 (GRCm39) P423T probably damaging Het
Trmt12 A G 15: 58,744,704 (GRCm39) D34G probably damaging Het
Ttc39b A G 4: 83,180,178 (GRCm39) Y72H probably damaging Het
Ttn G A 2: 76,708,755 (GRCm39) probably benign Het
Ttyh2 T A 11: 114,600,894 (GRCm39) I381N possibly damaging Het
Uaca A T 9: 60,777,814 (GRCm39) N734Y probably benign Het
Usp34 T C 11: 23,414,616 (GRCm39) I2853T probably benign Het
Usp34 G A 11: 23,438,659 (GRCm39) G3407D probably benign Het
Vmn2r78 A G 7: 86,570,238 (GRCm39) Y252C probably damaging Het
Yeats2 A T 16: 19,989,955 (GRCm39) H277L probably damaging Het
Zbtb2 T C 10: 4,319,267 (GRCm39) Y253C possibly damaging Het
Zfat C A 15: 68,051,677 (GRCm39) G706C probably damaging Het
Zfp106 A T 2: 120,350,898 (GRCm39) N1584K possibly damaging Het
Other mutations in Wdr19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Wdr19 APN 5 65,409,642 (GRCm39) missense probably benign 0.41
IGL01346:Wdr19 APN 5 65,379,082 (GRCm39) splice site probably benign
IGL01761:Wdr19 APN 5 65,373,163 (GRCm39) missense possibly damaging 0.60
IGL01845:Wdr19 APN 5 65,382,709 (GRCm39) missense probably damaging 0.98
IGL01977:Wdr19 APN 5 65,385,912 (GRCm39) missense probably benign
IGL02314:Wdr19 APN 5 65,414,463 (GRCm39) missense probably benign 0.26
IGL02455:Wdr19 APN 5 65,382,102 (GRCm39) missense probably benign 0.01
IGL02542:Wdr19 APN 5 65,388,414 (GRCm39) missense probably benign
IGL02616:Wdr19 APN 5 65,380,924 (GRCm39) missense probably damaging 0.97
IGL02661:Wdr19 APN 5 65,403,151 (GRCm39) missense probably benign 0.06
IGL02927:Wdr19 APN 5 65,409,721 (GRCm39) missense possibly damaging 0.80
IGL02958:Wdr19 APN 5 65,370,150 (GRCm39) splice site probably null
IGL03083:Wdr19 APN 5 65,388,319 (GRCm39) missense probably benign 0.01
IGL03332:Wdr19 APN 5 65,384,486 (GRCm39) missense possibly damaging 0.89
detritus UTSW 5 65,370,234 (GRCm39) missense possibly damaging 0.59
R4609_Wdr19_503 UTSW 5 65,385,885 (GRCm39) missense possibly damaging 0.83
R7190_Wdr19_539 UTSW 5 65,398,205 (GRCm39) missense probably benign 0.35
refuse UTSW 5 65,385,635 (GRCm39) missense possibly damaging 0.64
R0924:Wdr19 UTSW 5 65,413,782 (GRCm39) splice site probably benign
R1178:Wdr19 UTSW 5 65,381,208 (GRCm39) missense probably damaging 0.98
R1229:Wdr19 UTSW 5 65,413,734 (GRCm39) missense possibly damaging 0.94
R1434:Wdr19 UTSW 5 65,380,847 (GRCm39) splice site probably benign
R1543:Wdr19 UTSW 5 65,382,033 (GRCm39) missense probably benign 0.06
R1819:Wdr19 UTSW 5 65,370,234 (GRCm39) missense possibly damaging 0.59
R1971:Wdr19 UTSW 5 65,398,503 (GRCm39) splice site probably benign
R2190:Wdr19 UTSW 5 65,401,509 (GRCm39) missense possibly damaging 0.89
R2274:Wdr19 UTSW 5 65,398,334 (GRCm39) missense possibly damaging 0.62
R3106:Wdr19 UTSW 5 65,359,966 (GRCm39) missense probably benign 0.20
R3753:Wdr19 UTSW 5 65,382,069 (GRCm39) missense probably damaging 1.00
R3893:Wdr19 UTSW 5 65,385,635 (GRCm39) missense possibly damaging 0.64
R4609:Wdr19 UTSW 5 65,385,885 (GRCm39) missense possibly damaging 0.83
R5284:Wdr19 UTSW 5 65,382,752 (GRCm39) missense probably damaging 1.00
R5530:Wdr19 UTSW 5 65,385,562 (GRCm39) missense probably benign
R5837:Wdr19 UTSW 5 65,360,300 (GRCm39) missense probably benign 0.08
R5902:Wdr19 UTSW 5 65,384,482 (GRCm39) missense probably benign 0.09
R6065:Wdr19 UTSW 5 65,379,056 (GRCm39) missense probably benign
R6419:Wdr19 UTSW 5 65,373,236 (GRCm39) missense possibly damaging 0.63
R6495:Wdr19 UTSW 5 65,415,466 (GRCm39) missense probably benign 0.00
R6916:Wdr19 UTSW 5 65,382,677 (GRCm39) missense possibly damaging 0.64
R7020:Wdr19 UTSW 5 65,413,657 (GRCm39) missense probably damaging 0.99
R7190:Wdr19 UTSW 5 65,398,205 (GRCm39) missense probably benign 0.35
R7972:Wdr19 UTSW 5 65,381,193 (GRCm39) missense probably damaging 1.00
R8328:Wdr19 UTSW 5 65,382,638 (GRCm39) missense probably damaging 0.97
R8390:Wdr19 UTSW 5 65,381,210 (GRCm39) nonsense probably null
R8960:Wdr19 UTSW 5 65,398,211 (GRCm39) missense probably benign
R9260:Wdr19 UTSW 5 65,363,789 (GRCm39) missense possibly damaging 0.90
X0028:Wdr19 UTSW 5 65,401,487 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTGTCAGGTATAAATAGATAACGC -3'
(R):5'- GCATAGGTTATACAGGCGAGCC -3'

Sequencing Primer
(F):5'- CAGCATTAGTGTGGGTCTTCACC -3'
(R):5'- CTGTGTGCACACCCCTCTGAG -3'
Posted On 2016-08-04