Mutagenetix > Incidental Mutation

Incidental Mutation 'R5328:Axl'

422136

Institutional Source

Beutler Lab

Gene Symbol

Axl

Ensembl Gene

ENSMUSG00000002602

Gene Name

AXL receptor tyrosine kinase

Synonyms

Tyro7, Ufo, Ark

MMRRC Submission

042843-MU

Accession Numbers

Genbank: NM_009465; MGI: 1347244

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5328 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25757273-25788705 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25773411 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 400 (V400E)

Ref Sequence

ENSEMBL: ENSMUSP00000002677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002677] [ENSMUST00000085948]

AlphaFold

Q00993

Predicted Effect

probably damaging
Transcript: ENSMUST00000002677
AA Change: V400E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000002677
Gene: ENSMUSG00000002602
AA Change: V400E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	35	124	5.53e-6	SMART
IG	139	218	9.06e-2	SMART
FN3	219	312	9.25e-6	SMART
FN3	328	409	2.18e-2	SMART
transmembrane domain	444	466	N/A	INTRINSIC
low complexity region	489	501	N/A	INTRINSIC
TyrKc	530	797	1.91e-134	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000085948
AA Change: V400E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000083110
Gene: ENSMUSG00000002602
AA Change: V400E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	35	124	5.53e-6	SMART
IG	139	218	9.06e-2	SMART
FN3	219	312	9.25e-6	SMART
FN3	328	409	2.18e-2	SMART
transmembrane domain	435	457	N/A	INTRINSIC
low complexity region	480	492	N/A	INTRINSIC
TyrKc	521	788	1.91e-134	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132038

SMART Domains

Protein: ENSMUSP00000114907
Gene: ENSMUSG00000002602

Domain	Start	End	E-Value	Type
Blast:FN3	2	42	8e-20	BLAST
SCOP:d1gh7a2	2	61	4e-7	SMART
transmembrane domain	68	90	N/A	INTRINSIC
low complexity region	113	125	N/A	INTRINSIC
Pfam:Pkinase_Tyr	154	188	4.1e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132989

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity abnormalities, and aberrant apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,837,694	V860E	possibly damaging	Het
Abcc6	T	C	7: 45,992,311	D881G	probably benign	Het
Abcc9	A	G	6: 142,682,059	V415A	probably benign	Het
Adgrb3	A	C	1: 25,094,275	N1003K	possibly damaging	Het
Adora3	C	T	3: 105,907,303	T123I	probably benign	Het
Amotl2	A	C	9: 102,723,768	T345P	probably benign	Het
Arap3	C	T	18: 37,991,687	E247K	possibly damaging	Het
Atp8b1	A	T	18: 64,531,391	D1235E	probably benign	Het
Brd8	T	A	18: 34,607,981	N431Y	probably benign	Het
Cadps	A	T	14: 12,457,790	N1025K	probably benign	Het
Cblc	A	T	7: 19,792,580	S195T	possibly damaging	Het
Chd2	C	T	7: 73,463,681	A1184T	possibly damaging	Het
Chst10	G	A	1: 38,895,962		probably benign	Het
Col12a1	T	C	9: 79,620,060	K2663E	probably damaging	Het
Cspg4	A	T	9: 56,885,856	I292L	probably benign	Het
Cul1	T	C	6: 47,508,317	V294A	probably damaging	Het
Cyp2d11	G	A	15: 82,391,771	P203L	probably benign	Het
Dscam	T	C	16: 96,673,678	H1228R	probably benign	Het
Eif3l	A	T	15: 79,093,361	K534*	probably null	Het
Enpep	T	C	3: 129,280,510	E796G	probably benign	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam117a	T	A	11: 95,364,170		probably null	Het
Fan1	A	T	7: 64,354,469	Y750N	probably damaging	Het
Fat4	T	A	3: 38,956,868	I2039N	probably damaging	Het
Gabrr2	G	T	4: 33,082,565	D106Y	probably damaging	Het
Gak	A	C	5: 108,617,001	C145G	possibly damaging	Het
Galnt14	A	T	17: 73,505,459	N406K	possibly damaging	Het
Gm10439	T	G	X: 149,636,163	*434E	probably null	Het
Gm10837	G	T	14: 122,490,778	R22L	unknown	Het
Gm19965	T	A	1: 116,821,418	H276Q	possibly damaging	Het
Gm43517	T	C	12: 49,391,156		probably benign	Het
Gm9733	T	C	3: 15,332,174	M17V	unknown	Het
Greb1l	A	T	18: 10,553,720	I1574F	probably damaging	Het
Gzme	G	A	14: 56,117,767	H236Y	probably benign	Het
Heatr5b	G	A	17: 78,826,362	T266I	possibly damaging	Het
Hk3	T	C	13: 55,013,493	I185V	probably benign	Het
Hnrnpr	A	G	4: 136,339,216	E302G	probably benign	Het
Itgal	T	C	7: 127,311,675		probably null	Het
Itk	A	G	11: 46,331,876	S583P	probably benign	Het
Loxhd1	A	T	18: 77,410,572	I1448F	probably damaging	Het
Macf1	GCCCCC	GCCCCCC	4: 123,350,991		probably null	Het
Man2a2	A	T	7: 80,368,756	F118L	probably benign	Het
Mfsd5	T	A	15: 102,281,012	V273E	probably damaging	Het
Nfe2l2	A	G	2: 75,676,856	L300P	probably damaging	Het
Nt5c1a	T	G	4: 123,208,993	L122R	possibly damaging	Het
Nt5c3b	A	G	11: 100,440,241	F42S	probably damaging	Het
Olfr332	C	A	11: 58,490,429	A109S	possibly damaging	Het
Olfr577	T	A	7: 102,973,968	N8I	possibly damaging	Het
Pabpc1	A	T	15: 36,602,877	D204E	probably benign	Het
Panx2	A	G	15: 89,068,095	N255S	probably damaging	Het
Pcnt	A	G	10: 76,411,719	L993P	probably damaging	Het
Pfas	A	T	11: 68,988,592	C1160S	probably damaging	Het
Plekhh3	T	A	11: 101,167,658		probably benign	Het
Plod3	T	A	5: 136,989,683	N258K	probably damaging	Het
Prr14l	T	C	5: 32,830,021	Q710R	probably benign	Het
Rnf216	G	T	5: 143,092,999	T65K	possibly damaging	Het
Samd9l	T	C	6: 3,376,739	E174G	probably damaging	Het
Sept12	T	A	16: 4,993,993	M63L	possibly damaging	Het
Sh3bgrl2	T	A	9: 83,577,456	D22E	probably benign	Het
Skil	A	G	3: 31,117,569	K488R	probably benign	Het
Slamf6	T	A	1: 171,938,095	I262K	probably benign	Het
Slc27a3	T	C	3: 90,386,832	D470G	probably damaging	Het
Sorbs3	A	T	14: 70,181,174	V680E	probably damaging	Het
Sox9	C	T	11: 112,782,658	T25I	probably benign	Het
Srsf1	G	T	11: 88,049,993		probably benign	Het
Stard9	A	C	2: 120,699,230	E1989D	probably damaging	Het
Thumpd2	T	A	17: 81,044,162	I277F	possibly damaging	Het
Tinag	C	A	9: 77,005,631	G299*	probably null	Het
Tk2	A	T	8: 104,229,299		probably null	Het
Tmem44	A	G	16: 30,540,891	S210P	possibly damaging	Het
Traf3ip1	C	A	1: 91,520,069	P423T	probably damaging	Het
Trmt12	A	G	15: 58,872,855	D34G	probably damaging	Het
Ttc39b	A	G	4: 83,261,941	Y72H	probably damaging	Het
Ttn	G	A	2: 76,878,411		probably benign	Het
Ttyh2	T	A	11: 114,710,068	I381N	possibly damaging	Het
Uaca	A	T	9: 60,870,532	N734Y	probably benign	Het
Usp34	T	C	11: 23,464,616	I2853T	probably benign	Het
Usp34	G	A	11: 23,488,659	G3407D	probably benign	Het
Vmn2r78	A	G	7: 86,921,030	Y252C	probably damaging	Het
Wdr19	G	A	5: 65,244,179	C979Y	probably damaging	Het
Wdr92	C	A	11: 17,222,220	P103Q	probably damaging	Het
Yeats2	A	T	16: 20,171,205	H277L	probably damaging	Het
Zbtb2	T	C	10: 4,369,267	Y253C	possibly damaging	Het
Zfat	C	A	15: 68,179,828	G706C	probably damaging	Het
Zfp106	A	T	2: 120,520,417	N1584K	possibly damaging	Het

Other mutations in Axl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Axl	APN	7	25785899	missense	probably benign	0.16
IGL00428:Axl	APN	7	25760872	missense	probably damaging	1.00
IGL00725:Axl	APN	7	25764483	missense	probably damaging	0.97
IGL01348:Axl	APN	7	25763309	missense	probably damaging	1.00
IGL01350:Axl	APN	7	25758750	missense	probably damaging	1.00
IGL01357:Axl	APN	7	25774169	missense	probably benign	0.00
IGL02314:Axl	APN	7	25786920	missense	possibly damaging	0.50
IGL02321:Axl	APN	7	25758769	missense	probably damaging	1.00
IGL02839:Axl	APN	7	25766791	critical splice donor site	probably null
IGL02878:Axl	APN	7	25758877	missense	probably damaging	0.99
R0125:Axl	UTSW	7	25786943	missense	probably benign	0.00
R0529:Axl	UTSW	7	25787287	splice site	probably benign
R0539:Axl	UTSW	7	25778717	unclassified	probably benign
R0614:Axl	UTSW	7	25774163	missense	probably benign	0.18
R0747:Axl	UTSW	7	25764059	missense	possibly damaging	0.95
R1599:Axl	UTSW	7	25763969	missense	probably damaging	0.99
R1727:Axl	UTSW	7	25760766	missense	possibly damaging	0.68
R1880:Axl	UTSW	7	25774548	missense	probably damaging	1.00
R2206:Axl	UTSW	7	25770636	missense	probably damaging	1.00
R2513:Axl	UTSW	7	25787516	missense	probably benign
R2877:Axl	UTSW	7	25766524	missense	probably damaging	0.96
R3802:Axl	UTSW	7	25788477	start codon destroyed	probably null	0.98
R3915:Axl	UTSW	7	25760744	splice site	probably benign
R4064:Axl	UTSW	7	25764020	missense	probably benign	0.36
R4072:Axl	UTSW	7	25763911	unclassified	probably benign
R4073:Axl	UTSW	7	25763911	unclassified	probably benign
R4074:Axl	UTSW	7	25763911	unclassified	probably benign
R4378:Axl	UTSW	7	25758837	missense	probably benign	0.06
R5039:Axl	UTSW	7	25785915	missense	probably damaging	1.00
R5224:Axl	UTSW	7	25786944	missense	probably benign	0.00
R5519:Axl	UTSW	7	25778662	missense	possibly damaging	0.93
R5885:Axl	UTSW	7	25766852	missense	probably damaging	1.00
R6367:Axl	UTSW	7	25787433	missense	probably damaging	1.00
R6447:Axl	UTSW	7	25770283	missense	probably damaging	0.96
R6931:Axl	UTSW	7	25761433	missense	probably damaging	1.00
R7172:Axl	UTSW	7	25786974	missense	probably benign	0.33
R7355:Axl	UTSW	7	25774106	missense	probably benign	0.22
R7410:Axl	UTSW	7	25758783	missense	probably benign	0.06
R8274:Axl	UTSW	7	25764013	missense	probably damaging	0.99
R8279:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8281:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8282:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8283:Axl	UTSW	7	25763954	missense	probably benign	0.07
R8546:Axl	UTSW	7	25774163	missense	probably benign	0.00
R8742:Axl	UTSW	7	25764436	missense	probably damaging	0.99
R9002:Axl	UTSW	7	25778678	missense	probably damaging	0.97
R9139:Axl	UTSW	7	25761421	missense	probably damaging	1.00
R9179:Axl	UTSW	7	25770233	missense	probably damaging	0.97
R9324:Axl	UTSW	7	25761557	missense	probably damaging	1.00
R9343:Axl	UTSW	7	25774119	missense	probably damaging	1.00
R9352:Axl	UTSW	7	25763327	missense	possibly damaging	0.73
X0027:Axl	UTSW	7	25770268	missense	probably damaging	1.00
Z1177:Axl	UTSW	7	25761526	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCAGGGTAGCAACAGAGTC -3'
(R):5'- TATCTGGGCTAGCTGTACCC -3'

Sequencing Primer
(F):5'- CTCAGGGTAGCAACAGAGTCTAAGC -3'
(R):5'- CTTCAACAAATGCTGAGCTGTGC -3'

Posted On

2016-08-04