Incidental Mutation 'R5328:Itgal'
ID 422145
Institutional Source Beutler Lab
Gene Symbol Itgal
Ensembl Gene ENSMUSG00000030830
Gene Name integrin alpha L
Synonyms Ly-21, Ly-15, Cd11a, LFA-1
MMRRC Submission 042843-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R5328 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 126895432-126934310 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 126910847 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106306] [ENSMUST00000117762] [ENSMUST00000118405] [ENSMUST00000120857] [ENSMUST00000170971]
AlphaFold P24063
Predicted Effect probably null
Transcript: ENSMUST00000106306
SMART Domains Protein: ENSMUSP00000101913
Gene: ENSMUSG00000030830

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1043 1059 N/A INTRINSIC
transmembrane domain 1087 1109 N/A INTRINSIC
Pfam:Integrin_alpha 1110 1124 5.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117762
SMART Domains Protein: ENSMUSP00000113946
Gene: ENSMUSG00000030830

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 5.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118405
SMART Domains Protein: ENSMUSP00000112591
Gene: ENSMUSG00000030830

DomainStartEndE-ValueType
Int_alpha 2 54 4.21e-3 SMART
Int_alpha 58 113 9.6e-7 SMART
Int_alpha 119 172 3.58e-15 SMART
Int_alpha 179 228 1.28e1 SMART
low complexity region 646 662 N/A INTRINSIC
transmembrane domain 690 712 N/A INTRINSIC
Pfam:Integrin_alpha 713 727 2.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120857
SMART Domains Protein: ENSMUSP00000113396
Gene: ENSMUSG00000030830

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170971
SMART Domains Protein: ENSMUSP00000131847
Gene: ENSMUSG00000030830

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 38 81 5.01e0 SMART
VWA 151 327 2.68e-32 SMART
Int_alpha 398 450 1.27e-6 SMART
Int_alpha 454 509 9.6e-7 SMART
Int_alpha 515 568 3.58e-15 SMART
Int_alpha 575 624 1.28e1 SMART
low complexity region 1042 1058 N/A INTRINSIC
transmembrane domain 1086 1108 N/A INTRINSIC
Pfam:Integrin_alpha 1109 1123 1.2e-6 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mutations of this gene lead to increased leukocyte cell number, alter T cell activation, leukocyte migration and adhesion, spleen and lymph node morphology, and may affect humoral immune responses, metastatic potential, and susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,887,694 (GRCm39) V860E possibly damaging Het
Abcc6 T C 7: 45,641,735 (GRCm39) D881G probably benign Het
Abcc9 A G 6: 142,627,785 (GRCm39) V415A probably benign Het
Adgrb3 A C 1: 25,133,356 (GRCm39) N1003K possibly damaging Het
Adora3 C T 3: 105,814,619 (GRCm39) T123I probably benign Het
Amotl2 A C 9: 102,600,967 (GRCm39) T345P probably benign Het
Arap3 C T 18: 38,124,740 (GRCm39) E247K possibly damaging Het
Atp8b1 A T 18: 64,664,462 (GRCm39) D1235E probably benign Het
Axl A T 7: 25,472,836 (GRCm39) V400E probably damaging Het
Brd8 T A 18: 34,741,034 (GRCm39) N431Y probably benign Het
Cadps A T 14: 12,457,790 (GRCm38) N1025K probably benign Het
Cblc A T 7: 19,526,505 (GRCm39) S195T possibly damaging Het
Chd2 C T 7: 73,113,429 (GRCm39) A1184T possibly damaging Het
Chst10 G A 1: 38,935,043 (GRCm39) probably benign Het
Col12a1 T C 9: 79,527,342 (GRCm39) K2663E probably damaging Het
Cspg4 A T 9: 56,793,140 (GRCm39) I292L probably benign Het
Cul1 T C 6: 47,485,251 (GRCm39) V294A probably damaging Het
Cyp2d11 G A 15: 82,275,972 (GRCm39) P203L probably benign Het
Dnaaf10 C A 11: 17,172,220 (GRCm39) P103Q probably damaging Het
Dscam T C 16: 96,474,878 (GRCm39) H1228R probably benign Het
Eif3l A T 15: 78,977,561 (GRCm39) K534* probably null Het
Enpep T C 3: 129,074,159 (GRCm39) E796G probably benign Het
Ext1 C A 15: 52,939,213 (GRCm39) W612L probably damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fam117a T A 11: 95,254,996 (GRCm39) probably null Het
Fan1 A T 7: 64,004,217 (GRCm39) Y750N probably damaging Het
Fat4 T A 3: 39,011,017 (GRCm39) I2039N probably damaging Het
Gabrr2 G T 4: 33,082,565 (GRCm39) D106Y probably damaging Het
Gak A C 5: 108,764,867 (GRCm39) C145G possibly damaging Het
Galnt14 A T 17: 73,812,454 (GRCm39) N406K possibly damaging Het
Gm10439 T G X: 148,419,159 (GRCm39) *434E probably null Het
Gm10837 G T 14: 122,728,190 (GRCm39) R22L unknown Het
Gm19965 T A 1: 116,749,148 (GRCm39) H276Q possibly damaging Het
Gm43517 T C 12: 49,437,939 (GRCm39) probably benign Het
Greb1l A T 18: 10,553,720 (GRCm39) I1574F probably damaging Het
Gzme G A 14: 56,355,224 (GRCm39) H236Y probably benign Het
Heatr5b G A 17: 79,133,791 (GRCm39) T266I possibly damaging Het
Hk3 T C 13: 55,161,306 (GRCm39) I185V probably benign Het
Hnrnpr A G 4: 136,066,527 (GRCm39) E302G probably benign Het
Itk A G 11: 46,222,703 (GRCm39) S583P probably benign Het
Loxhd1 A T 18: 77,498,268 (GRCm39) I1448F probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,244,784 (GRCm39) probably null Het
Man2a2 A T 7: 80,018,504 (GRCm39) F118L probably benign Het
Mfsd5 T A 15: 102,189,447 (GRCm39) V273E probably damaging Het
Nfe2l2 A G 2: 75,507,200 (GRCm39) L300P probably damaging Het
Nt5c1a T G 4: 123,102,786 (GRCm39) L122R possibly damaging Het
Nt5c3b A G 11: 100,331,067 (GRCm39) F42S probably damaging Het
Or2av9 C A 11: 58,381,255 (GRCm39) A109S possibly damaging Het
Or51g2 T A 7: 102,623,175 (GRCm39) N8I possibly damaging Het
Pabpc1 A T 15: 36,603,121 (GRCm39) D204E probably benign Het
Panx2 A G 15: 88,952,298 (GRCm39) N255S probably damaging Het
Pcnt A G 10: 76,247,553 (GRCm39) L993P probably damaging Het
Pfas A T 11: 68,879,418 (GRCm39) C1160S probably damaging Het
Plekhh3 T A 11: 101,058,484 (GRCm39) probably benign Het
Plod3 T A 5: 137,018,537 (GRCm39) N258K probably damaging Het
Prr14l T C 5: 32,987,365 (GRCm39) Q710R probably benign Het
Rnf216 G T 5: 143,078,754 (GRCm39) T65K possibly damaging Het
Samd9l T C 6: 3,376,739 (GRCm39) E174G probably damaging Het
Septin12 T A 16: 4,811,857 (GRCm39) M63L possibly damaging Het
Sh3bgrl2 T A 9: 83,459,509 (GRCm39) D22E probably benign Het
Sirpd T C 3: 15,397,234 (GRCm39) M17V unknown Het
Skil A G 3: 31,171,718 (GRCm39) K488R probably benign Het
Slamf6 T A 1: 171,765,662 (GRCm39) I262K probably benign Het
Slc27a3 T C 3: 90,294,139 (GRCm39) D470G probably damaging Het
Sorbs3 A T 14: 70,418,623 (GRCm39) V680E probably damaging Het
Sox9 C T 11: 112,673,484 (GRCm39) T25I probably benign Het
Srsf1 G T 11: 87,940,819 (GRCm39) probably benign Het
Stard9 A C 2: 120,529,711 (GRCm39) E1989D probably damaging Het
Thumpd2 T A 17: 81,351,591 (GRCm39) I277F possibly damaging Het
Tinag C A 9: 76,912,913 (GRCm39) G299* probably null Het
Tk2 A T 8: 104,955,931 (GRCm39) probably null Het
Tmem44 A G 16: 30,359,709 (GRCm39) S210P possibly damaging Het
Traf3ip1 C A 1: 91,447,791 (GRCm39) P423T probably damaging Het
Trmt12 A G 15: 58,744,704 (GRCm39) D34G probably damaging Het
Ttc39b A G 4: 83,180,178 (GRCm39) Y72H probably damaging Het
Ttn G A 2: 76,708,755 (GRCm39) probably benign Het
Ttyh2 T A 11: 114,600,894 (GRCm39) I381N possibly damaging Het
Uaca A T 9: 60,777,814 (GRCm39) N734Y probably benign Het
Usp34 T C 11: 23,414,616 (GRCm39) I2853T probably benign Het
Usp34 G A 11: 23,438,659 (GRCm39) G3407D probably benign Het
Vmn2r78 A G 7: 86,570,238 (GRCm39) Y252C probably damaging Het
Wdr19 G A 5: 65,401,522 (GRCm39) C979Y probably damaging Het
Yeats2 A T 16: 19,989,955 (GRCm39) H277L probably damaging Het
Zbtb2 T C 10: 4,319,267 (GRCm39) Y253C possibly damaging Het
Zfat C A 15: 68,051,677 (GRCm39) G706C probably damaging Het
Zfp106 A T 2: 120,350,898 (GRCm39) N1584K possibly damaging Het
Other mutations in Itgal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Itgal APN 7 126,901,183 (GRCm39) missense probably damaging 0.99
IGL01300:Itgal APN 7 126,913,290 (GRCm39) missense probably damaging 1.00
IGL01345:Itgal APN 7 126,900,128 (GRCm39) missense possibly damaging 0.56
IGL01826:Itgal APN 7 126,901,318 (GRCm39) missense probably benign 0.16
IGL02202:Itgal APN 7 126,929,351 (GRCm39) nonsense probably null
IGL02212:Itgal APN 7 126,900,152 (GRCm39) missense probably benign 0.00
IGL02513:Itgal APN 7 126,927,844 (GRCm39) missense possibly damaging 0.78
IGL02608:Itgal APN 7 126,909,416 (GRCm39) missense probably damaging 1.00
IGL02946:Itgal APN 7 126,913,540 (GRCm39) missense probably damaging 0.99
sunglow UTSW 7 126,927,919 (GRCm39) missense probably null 0.89
R0069:Itgal UTSW 7 126,909,503 (GRCm39) missense probably benign 0.44
R0069:Itgal UTSW 7 126,909,503 (GRCm39) missense probably benign 0.44
R0107:Itgal UTSW 7 126,927,731 (GRCm39) splice site probably benign
R0331:Itgal UTSW 7 126,905,853 (GRCm39) splice site probably null
R0350:Itgal UTSW 7 126,921,253 (GRCm39) missense probably damaging 1.00
R0380:Itgal UTSW 7 126,909,923 (GRCm39) nonsense probably null
R0537:Itgal UTSW 7 126,910,445 (GRCm39) missense possibly damaging 0.61
R0546:Itgal UTSW 7 126,909,486 (GRCm39) missense probably benign 0.00
R0594:Itgal UTSW 7 126,913,232 (GRCm39) missense probably damaging 1.00
R1167:Itgal UTSW 7 126,900,111 (GRCm39) missense probably damaging 1.00
R1377:Itgal UTSW 7 126,921,089 (GRCm39) missense probably damaging 1.00
R1575:Itgal UTSW 7 126,900,060 (GRCm39) critical splice acceptor site probably null
R1690:Itgal UTSW 7 126,901,289 (GRCm39) missense possibly damaging 0.56
R1693:Itgal UTSW 7 126,904,453 (GRCm39) missense probably damaging 1.00
R1702:Itgal UTSW 7 126,904,197 (GRCm39) missense probably benign 0.00
R1720:Itgal UTSW 7 126,906,099 (GRCm39) missense probably benign 0.00
R1774:Itgal UTSW 7 126,908,794 (GRCm39) critical splice donor site probably null
R1824:Itgal UTSW 7 126,913,232 (GRCm39) missense probably damaging 1.00
R1878:Itgal UTSW 7 126,909,843 (GRCm39) missense probably benign 0.44
R1951:Itgal UTSW 7 126,929,317 (GRCm39) missense probably damaging 1.00
R2265:Itgal UTSW 7 126,905,873 (GRCm39) missense possibly damaging 0.63
R2267:Itgal UTSW 7 126,905,873 (GRCm39) missense possibly damaging 0.63
R2269:Itgal UTSW 7 126,905,873 (GRCm39) missense possibly damaging 0.63
R2276:Itgal UTSW 7 126,927,919 (GRCm39) missense probably null 0.89
R2570:Itgal UTSW 7 126,913,268 (GRCm39) missense probably damaging 1.00
R3925:Itgal UTSW 7 126,923,709 (GRCm39) splice site probably benign
R4225:Itgal UTSW 7 126,904,484 (GRCm39) missense probably damaging 1.00
R4377:Itgal UTSW 7 126,927,453 (GRCm39) missense probably benign 0.00
R4466:Itgal UTSW 7 126,927,684 (GRCm39) missense possibly damaging 0.93
R4579:Itgal UTSW 7 126,904,466 (GRCm39) missense possibly damaging 0.83
R4656:Itgal UTSW 7 126,921,725 (GRCm39) missense probably damaging 1.00
R4771:Itgal UTSW 7 126,927,405 (GRCm39) missense probably damaging 1.00
R5012:Itgal UTSW 7 126,898,802 (GRCm39) critical splice donor site probably null
R5365:Itgal UTSW 7 126,904,522 (GRCm39) missense probably damaging 0.98
R5579:Itgal UTSW 7 126,906,101 (GRCm39) missense probably benign 0.10
R5849:Itgal UTSW 7 126,916,492 (GRCm39) missense probably benign 0.27
R5955:Itgal UTSW 7 126,904,161 (GRCm39) missense possibly damaging 0.82
R6254:Itgal UTSW 7 126,924,375 (GRCm39) missense probably damaging 1.00
R6269:Itgal UTSW 7 126,929,389 (GRCm39) missense probably null 1.00
R6520:Itgal UTSW 7 126,929,503 (GRCm39) missense probably benign 0.01
R6541:Itgal UTSW 7 126,910,734 (GRCm39) missense probably damaging 0.99
R7049:Itgal UTSW 7 126,895,573 (GRCm39) unclassified probably benign
R7168:Itgal UTSW 7 126,929,385 (GRCm39) missense probably benign
R7419:Itgal UTSW 7 126,906,047 (GRCm39) missense probably benign 0.01
R7424:Itgal UTSW 7 126,916,537 (GRCm39) missense probably benign 0.00
R7454:Itgal UTSW 7 126,926,936 (GRCm39) missense probably benign 0.00
R7567:Itgal UTSW 7 126,898,960 (GRCm39) missense probably benign 0.00
R7696:Itgal UTSW 7 126,929,356 (GRCm39) missense probably damaging 1.00
R7977:Itgal UTSW 7 126,927,470 (GRCm39) missense possibly damaging 0.88
R7987:Itgal UTSW 7 126,927,470 (GRCm39) missense possibly damaging 0.88
R8118:Itgal UTSW 7 126,910,417 (GRCm39) missense probably benign 0.08
R8297:Itgal UTSW 7 126,929,638 (GRCm39) missense unknown
R8418:Itgal UTSW 7 126,929,454 (GRCm39) missense probably benign 0.02
R8477:Itgal UTSW 7 126,900,105 (GRCm39) missense probably damaging 1.00
R8507:Itgal UTSW 7 126,928,607 (GRCm39) missense probably benign 0.26
R8789:Itgal UTSW 7 126,904,421 (GRCm39) missense probably benign 0.05
R8838:Itgal UTSW 7 126,910,433 (GRCm39) missense probably damaging 1.00
R8881:Itgal UTSW 7 126,929,541 (GRCm39) missense probably benign 0.11
R8923:Itgal UTSW 7 126,895,533 (GRCm39) unclassified probably benign
R9070:Itgal UTSW 7 126,927,873 (GRCm39) missense probably null 0.98
R9104:Itgal UTSW 7 126,910,794 (GRCm39) missense probably damaging 1.00
R9173:Itgal UTSW 7 126,896,789 (GRCm39) critical splice acceptor site probably null
R9179:Itgal UTSW 7 126,905,883 (GRCm39) missense probably benign 0.33
R9407:Itgal UTSW 7 126,921,796 (GRCm39) critical splice donor site probably null
R9545:Itgal UTSW 7 126,929,422 (GRCm39) missense probably damaging 1.00
R9681:Itgal UTSW 7 126,929,422 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCCTGACTTCCTGTAC -3'
(R):5'- AACGGAGAAACTTGGGTCCC -3'

Sequencing Primer
(F):5'- GCCTGACTTCCTGTACCTGGC -3'
(R):5'- GAACCCGAGCCAGCAGATTTG -3'
Posted On 2016-08-04