Mutagenetix > Incidental Mutation

Incidental Mutation 'R5328:Col12a1'

422149

Institutional Source

Beutler Lab

Gene Symbol

Col12a1

Ensembl Gene

ENSMUSG00000032332

Gene Name

collagen, type XII, alpha 1

Synonyms

MMRRC Submission

042843-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.810) question?

Stock #

R5328 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79598991-79718831 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79620060 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 2663 (K2663E)

Ref Sequence

ENSEMBL: ENSMUSP00000071662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071750
AA Change: K2663E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: K2663E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	25	103	2.29e-10	SMART
low complexity region	114	129	N/A	INTRINSIC
VWA	138	317	4e-63	SMART
FN3	334	413	1.47e-8	SMART
VWA	438	617	2.41e-57	SMART
FN3	632	710	1.62e-10	SMART
FN3	723	801	2.91e-12	SMART
FN3	814	892	6.05e-10	SMART
FN3	905	984	2.74e-8	SMART
FN3	995	1074	1.24e-6	SMART
FN3	1087	1166	5.78e-7	SMART
VWA	1197	1376	2.02e-59	SMART
FN3	1385	1463	1.13e-9	SMART
FN3	1474	1554	1.07e-10	SMART
FN3	1566	1643	3.73e-10	SMART
FN3	1655	1734	2.94e-8	SMART
FN3	1755	1834	1.54e-11	SMART
FN3	1846	1924	1.45e-7	SMART
FN3	1936	2015	1.47e-8	SMART
FN3	2027	2106	1.21e-9	SMART
FN3	2118	2195	2.14e-10	SMART
FN3	2206	2285	3.85e-3	SMART
low complexity region	2292	2314	N/A	INTRINSIC
VWA	2323	2503	2.61e-53	SMART
TSPN	2522	2714	1.13e-76	SMART
Pfam:Collagen	2747	2804	1.7e-8	PFAM
Pfam:Collagen	2802	2855	6.5e-9	PFAM
Pfam:Collagen	2844	2904	1.1e-9	PFAM
Pfam:Collagen	2939	2994	4.6e-8	PFAM
low complexity region	3011	3044	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121227
AA Change: K2663E

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: K2663E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	25	103	2.29e-10	SMART
low complexity region	114	129	N/A	INTRINSIC
VWA	138	317	4e-63	SMART
FN3	334	413	1.47e-8	SMART
VWA	438	617	2.41e-57	SMART
FN3	632	710	1.62e-10	SMART
FN3	723	801	2.91e-12	SMART
FN3	814	892	6.05e-10	SMART
FN3	905	984	2.74e-8	SMART
FN3	995	1074	1.24e-6	SMART
FN3	1087	1166	5.78e-7	SMART
VWA	1197	1376	2.02e-59	SMART
FN3	1385	1463	1.13e-9	SMART
FN3	1474	1554	1.07e-10	SMART
FN3	1566	1643	3.73e-10	SMART
FN3	1655	1734	2.94e-8	SMART
FN3	1755	1834	1.54e-11	SMART
FN3	1846	1924	1.45e-7	SMART
FN3	1936	2015	1.47e-8	SMART
FN3	2027	2106	1.21e-9	SMART
FN3	2118	2195	2.14e-10	SMART
FN3	2206	2285	3.85e-3	SMART
low complexity region	2292	2314	N/A	INTRINSIC
VWA	2323	2503	2.61e-53	SMART
TSPN	2522	2714	1.13e-76	SMART
Pfam:Collagen	2747	2804	4.7e-9	PFAM
Pfam:Collagen	2802	2861	2.9e-9	PFAM
Pfam:Collagen	2838	2900	7.1e-8	PFAM
Pfam:Collagen	2935	2990	1.3e-8	PFAM
low complexity region	3007	3040	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,837,694	V860E	possibly damaging	Het
Abcc6	T	C	7: 45,992,311	D881G	probably benign	Het
Abcc9	A	G	6: 142,682,059	V415A	probably benign	Het
Adgrb3	A	C	1: 25,094,275	N1003K	possibly damaging	Het
Adora3	C	T	3: 105,907,303	T123I	probably benign	Het
Amotl2	A	C	9: 102,723,768	T345P	probably benign	Het
Arap3	C	T	18: 37,991,687	E247K	possibly damaging	Het
Atp8b1	A	T	18: 64,531,391	D1235E	probably benign	Het
Axl	A	T	7: 25,773,411	V400E	probably damaging	Het
Brd8	T	A	18: 34,607,981	N431Y	probably benign	Het
Cadps	A	T	14: 12,457,790	N1025K	probably benign	Het
Cblc	A	T	7: 19,792,580	S195T	possibly damaging	Het
Chd2	C	T	7: 73,463,681	A1184T	possibly damaging	Het
Chst10	G	A	1: 38,895,962		probably benign	Het
Cspg4	A	T	9: 56,885,856	I292L	probably benign	Het
Cul1	T	C	6: 47,508,317	V294A	probably damaging	Het
Cyp2d11	G	A	15: 82,391,771	P203L	probably benign	Het
Dscam	T	C	16: 96,673,678	H1228R	probably benign	Het
Eif3l	A	T	15: 79,093,361	K534*	probably null	Het
Enpep	T	C	3: 129,280,510	E796G	probably benign	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam117a	T	A	11: 95,364,170		probably null	Het
Fan1	A	T	7: 64,354,469	Y750N	probably damaging	Het
Fat4	T	A	3: 38,956,868	I2039N	probably damaging	Het
Gabrr2	G	T	4: 33,082,565	D106Y	probably damaging	Het
Gak	A	C	5: 108,617,001	C145G	possibly damaging	Het
Galnt14	A	T	17: 73,505,459	N406K	possibly damaging	Het
Gm10439	T	G	X: 149,636,163	*434E	probably null	Het
Gm10837	G	T	14: 122,490,778	R22L	unknown	Het
Gm19965	T	A	1: 116,821,418	H276Q	possibly damaging	Het
Gm43517	T	C	12: 49,391,156		probably benign	Het
Gm9733	T	C	3: 15,332,174	M17V	unknown	Het
Greb1l	A	T	18: 10,553,720	I1574F	probably damaging	Het
Gzme	G	A	14: 56,117,767	H236Y	probably benign	Het
Heatr5b	G	A	17: 78,826,362	T266I	possibly damaging	Het
Hk3	T	C	13: 55,013,493	I185V	probably benign	Het
Hnrnpr	A	G	4: 136,339,216	E302G	probably benign	Het
Itgal	T	C	7: 127,311,675		probably null	Het
Itk	A	G	11: 46,331,876	S583P	probably benign	Het
Loxhd1	A	T	18: 77,410,572	I1448F	probably damaging	Het
Macf1	GCCCCC	GCCCCCC	4: 123,350,991		probably null	Het
Man2a2	A	T	7: 80,368,756	F118L	probably benign	Het
Mfsd5	T	A	15: 102,281,012	V273E	probably damaging	Het
Nfe2l2	A	G	2: 75,676,856	L300P	probably damaging	Het
Nt5c1a	T	G	4: 123,208,993	L122R	possibly damaging	Het
Nt5c3b	A	G	11: 100,440,241	F42S	probably damaging	Het
Olfr332	C	A	11: 58,490,429	A109S	possibly damaging	Het
Olfr577	T	A	7: 102,973,968	N8I	possibly damaging	Het
Pabpc1	A	T	15: 36,602,877	D204E	probably benign	Het
Panx2	A	G	15: 89,068,095	N255S	probably damaging	Het
Pcnt	A	G	10: 76,411,719	L993P	probably damaging	Het
Pfas	A	T	11: 68,988,592	C1160S	probably damaging	Het
Plekhh3	T	A	11: 101,167,658		probably benign	Het
Plod3	T	A	5: 136,989,683	N258K	probably damaging	Het
Prr14l	T	C	5: 32,830,021	Q710R	probably benign	Het
Rnf216	G	T	5: 143,092,999	T65K	possibly damaging	Het
Samd9l	T	C	6: 3,376,739	E174G	probably damaging	Het
Sept12	T	A	16: 4,993,993	M63L	possibly damaging	Het
Sh3bgrl2	T	A	9: 83,577,456	D22E	probably benign	Het
Skil	A	G	3: 31,117,569	K488R	probably benign	Het
Slamf6	T	A	1: 171,938,095	I262K	probably benign	Het
Slc27a3	T	C	3: 90,386,832	D470G	probably damaging	Het
Sorbs3	A	T	14: 70,181,174	V680E	probably damaging	Het
Sox9	C	T	11: 112,782,658	T25I	probably benign	Het
Srsf1	G	T	11: 88,049,993		probably benign	Het
Stard9	A	C	2: 120,699,230	E1989D	probably damaging	Het
Thumpd2	T	A	17: 81,044,162	I277F	possibly damaging	Het
Tinag	C	A	9: 77,005,631	G299*	probably null	Het
Tk2	A	T	8: 104,229,299		probably null	Het
Tmem44	A	G	16: 30,540,891	S210P	possibly damaging	Het
Traf3ip1	C	A	1: 91,520,069	P423T	probably damaging	Het
Trmt12	A	G	15: 58,872,855	D34G	probably damaging	Het
Ttc39b	A	G	4: 83,261,941	Y72H	probably damaging	Het
Ttn	G	A	2: 76,878,411		probably benign	Het
Ttyh2	T	A	11: 114,710,068	I381N	possibly damaging	Het
Uaca	A	T	9: 60,870,532	N734Y	probably benign	Het
Usp34	T	C	11: 23,464,616	I2853T	probably benign	Het
Usp34	G	A	11: 23,488,659	G3407D	probably benign	Het
Vmn2r78	A	G	7: 86,921,030	Y252C	probably damaging	Het
Wdr19	G	A	5: 65,244,179	C979Y	probably damaging	Het
Wdr92	C	A	11: 17,222,220	P103Q	probably damaging	Het
Yeats2	A	T	16: 20,171,205	H277L	probably damaging	Het
Zbtb2	T	C	10: 4,369,267	Y253C	possibly damaging	Het
Zfat	C	A	15: 68,179,828	G706C	probably damaging	Het
Zfp106	A	T	2: 120,520,417	N1584K	possibly damaging	Het

Other mutations in Col12a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Col12a1	APN	9	79681537	missense	possibly damaging	0.55
IGL00434:Col12a1	APN	9	79653332	missense	probably benign	0.27
IGL00465:Col12a1	APN	9	79697581	missense	probably damaging	1.00
IGL00568:Col12a1	APN	9	79651477	missense	probably damaging	1.00
IGL00576:Col12a1	APN	9	79647652	missense	probably damaging	1.00
IGL00580:Col12a1	APN	9	79692226	missense	probably benign	0.05
IGL01015:Col12a1	APN	9	79633741	missense	probably damaging	1.00
IGL01124:Col12a1	APN	9	79703847	missense	probably damaging	1.00
IGL01138:Col12a1	APN	9	79678053	missense	probably damaging	1.00
IGL01295:Col12a1	APN	9	79643926	missense	probably damaging	1.00
IGL01630:Col12a1	APN	9	79657366	missense	probably damaging	1.00
IGL01648:Col12a1	APN	9	79601169	makesense	probably null
IGL01878:Col12a1	APN	9	79649975	missense	possibly damaging	0.72
IGL01921:Col12a1	APN	9	79650017	missense	possibly damaging	0.50
IGL02064:Col12a1	APN	9	79692372	missense	probably benign	0.06
IGL02123:Col12a1	APN	9	79662458	critical splice donor site	probably null
IGL02312:Col12a1	APN	9	79681515	missense	probably damaging	1.00
IGL02320:Col12a1	APN	9	79616021	critical splice donor site	probably null
IGL02328:Col12a1	APN	9	79682066	missense	probably damaging	1.00
IGL02342:Col12a1	APN	9	79649896	splice site	probably null
IGL02355:Col12a1	APN	9	79630711	splice site	probably benign
IGL02362:Col12a1	APN	9	79630711	splice site	probably benign
IGL02396:Col12a1	APN	9	79662583	missense	probably benign
IGL02449:Col12a1	APN	9	79641469	missense	probably damaging	1.00
IGL02682:Col12a1	APN	9	79699341	missense	probably damaging	1.00
IGL02751:Col12a1	APN	9	79613859	unclassified	probably benign
IGL02801:Col12a1	APN	9	79608414	splice site	probably null
IGL03001:Col12a1	APN	9	79633673	missense	probably damaging	1.00
IGL03027:Col12a1	APN	9	79641551	missense	probably benign	0.40
IGL03090:Col12a1	APN	9	79678370	missense	probably damaging	1.00
IGL03115:Col12a1	APN	9	79681437	missense	probably damaging	1.00
IGL03220:Col12a1	APN	9	79699483	missense	probably damaging	1.00
IGL03240:Col12a1	APN	9	79678383	splice site	probably null
IGL03348:Col12a1	APN	9	79693430	missense	possibly damaging	0.88
airship	UTSW	9	79706337	missense	possibly damaging	0.65
dirigible	UTSW	9	79703829	missense	possibly damaging	0.73
Feast	UTSW	9	79700262	missense	probably benign	0.00
hardly	UTSW	9	79700350	nonsense	probably null
hearty	UTSW	9	79643966	missense	probably damaging	1.00
Hefty	UTSW	9	79662454	splice site	probably benign
P0045:Col12a1	UTSW	9	79647611	missense	probably damaging	0.99
PIT4260001:Col12a1	UTSW	9	79651380	critical splice donor site	probably null
PIT4280001:Col12a1	UTSW	9	79678105	missense	probably damaging	1.00
R0015:Col12a1	UTSW	9	79651385	missense	probably damaging	1.00
R0015:Col12a1	UTSW	9	79651385	missense	probably damaging	1.00
R0240:Col12a1	UTSW	9	79652033	missense	probably benign	0.02
R0276:Col12a1	UTSW	9	79630741	nonsense	probably null
R0309:Col12a1	UTSW	9	79600011	splice site	probably null
R0336:Col12a1	UTSW	9	79702345	missense	probably damaging	0.98
R0376:Col12a1	UTSW	9	79693494	missense	probably benign	0.10
R0413:Col12a1	UTSW	9	79699360	missense	probably damaging	0.99
R0504:Col12a1	UTSW	9	79681468	missense	possibly damaging	0.90
R0542:Col12a1	UTSW	9	79605328	critical splice donor site	probably null
R0610:Col12a1	UTSW	9	79707848	missense	probably benign
R0631:Col12a1	UTSW	9	79703376	missense	probably damaging	1.00
R0637:Col12a1	UTSW	9	79656735	missense	probably benign	0.00
R0667:Col12a1	UTSW	9	79628462	missense	probably damaging	1.00
R0711:Col12a1	UTSW	9	79652035	missense	probably damaging	1.00
R0717:Col12a1	UTSW	9	79612419	missense	probably damaging	1.00
R0762:Col12a1	UTSW	9	79681374	splice site	probably benign
R0787:Col12a1	UTSW	9	79638485	missense	probably damaging	0.99
R0890:Col12a1	UTSW	9	79700402	missense	probably damaging	0.97
R0900:Col12a1	UTSW	9	79684253	missense	possibly damaging	0.91
R1109:Col12a1	UTSW	9	79699723	missense	probably damaging	1.00
R1264:Col12a1	UTSW	9	79620089	missense	probably benign	0.09
R1321:Col12a1	UTSW	9	79617709	nonsense	probably null
R1344:Col12a1	UTSW	9	79699555	nonsense	probably null
R1387:Col12a1	UTSW	9	79681375	splice site	probably benign
R1511:Col12a1	UTSW	9	79699552	missense	probably benign	0.02
R1523:Col12a1	UTSW	9	79660996	missense	probably benign	0.01
R1526:Col12a1	UTSW	9	79656798	missense	probably benign	0.44
R1564:Col12a1	UTSW	9	79613840	missense	probably damaging	1.00
R1595:Col12a1	UTSW	9	79602254	missense	probably damaging	1.00
R1603:Col12a1	UTSW	9	79612962	missense	probably damaging	1.00
R1673:Col12a1	UTSW	9	79693538	missense	probably benign	0.00
R1730:Col12a1	UTSW	9	79628378	missense	possibly damaging	0.93
R1737:Col12a1	UTSW	9	79703451	missense	probably damaging	1.00
R1739:Col12a1	UTSW	9	79633468	missense	probably damaging	0.98
R1748:Col12a1	UTSW	9	79672997	missense	probably benign	0.01
R1778:Col12a1	UTSW	9	79604585	splice site	probably benign
R1845:Col12a1	UTSW	9	79697541	missense	probably benign	0.09
R1864:Col12a1	UTSW	9	79627103	splice site	probably null
R1876:Col12a1	UTSW	9	79678281	nonsense	probably null
R1934:Col12a1	UTSW	9	79604522	nonsense	probably null
R1942:Col12a1	UTSW	9	79635466	missense	probably damaging	1.00
R1950:Col12a1	UTSW	9	79630549	missense	possibly damaging	0.62
R2027:Col12a1	UTSW	9	79645793	critical splice acceptor site	probably null
R2061:Col12a1	UTSW	9	79617705	missense	possibly damaging	0.88
R2064:Col12a1	UTSW	9	79662454	splice site	probably benign
R2070:Col12a1	UTSW	9	79647696	missense	probably benign	0.00
R2112:Col12a1	UTSW	9	79643899	missense	possibly damaging	0.93
R2209:Col12a1	UTSW	9	79692352	missense	possibly damaging	0.83
R2275:Col12a1	UTSW	9	79635427	missense	probably damaging	0.99
R2330:Col12a1	UTSW	9	79633657	missense	probably damaging	0.99
R2373:Col12a1	UTSW	9	79656813	missense	probably benign	0.03
R2425:Col12a1	UTSW	9	79678366	missense	probably damaging	1.00
R2428:Col12a1	UTSW	9	79602251	missense	probably benign	0.30
R2437:Col12a1	UTSW	9	79692219	missense	probably damaging	0.97
R2831:Col12a1	UTSW	9	79697401	missense	probably null	0.99
R2851:Col12a1	UTSW	9	79678332	missense	probably damaging	1.00
R2872:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2872:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2874:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2904:Col12a1	UTSW	9	79652025	missense	probably damaging	1.00
R2905:Col12a1	UTSW	9	79652025	missense	probably damaging	1.00
R2991:Col12a1	UTSW	9	79700265	missense	probably damaging	1.00
R3402:Col12a1	UTSW	9	79643947	missense	probably damaging	1.00
R3429:Col12a1	UTSW	9	79680311	missense	probably benign
R3430:Col12a1	UTSW	9	79680311	missense	probably benign
R3547:Col12a1	UTSW	9	79633416	missense	probably damaging	1.00
R3789:Col12a1	UTSW	9	79639723	missense	possibly damaging	0.96
R4091:Col12a1	UTSW	9	79702364	missense	probably damaging	0.99
R4328:Col12a1	UTSW	9	79700389	missense	possibly damaging	0.91
R4382:Col12a1	UTSW	9	79630741	nonsense	probably null
R4392:Col12a1	UTSW	9	79662488	missense	probably damaging	1.00
R4405:Col12a1	UTSW	9	79639965	critical splice donor site	probably null
R4465:Col12a1	UTSW	9	79672910	missense	possibly damaging	0.62
R4521:Col12a1	UTSW	9	79633357	missense	probably benign	0.00
R4612:Col12a1	UTSW	9	79616057	missense	probably damaging	0.99
R4613:Col12a1	UTSW	9	79647601	missense	probably benign	0.03
R4649:Col12a1	UTSW	9	79639794	missense	probably damaging	1.00
R4651:Col12a1	UTSW	9	79612946	missense	probably damaging	1.00
R4652:Col12a1	UTSW	9	79612946	missense	probably damaging	1.00
R4738:Col12a1	UTSW	9	79699282	missense	probably damaging	1.00
R4745:Col12a1	UTSW	9	79652086	splice site	probably null
R4761:Col12a1	UTSW	9	79657310	missense	probably benign	0.34
R4784:Col12a1	UTSW	9	79678494	missense	possibly damaging	0.50
R4785:Col12a1	UTSW	9	79678494	missense	possibly damaging	0.50
R4809:Col12a1	UTSW	9	79693567	missense	probably benign	0.10
R4821:Col12a1	UTSW	9	79715340	intron	probably benign
R4925:Col12a1	UTSW	9	79674795	missense	probably damaging	1.00
R4938:Col12a1	UTSW	9	79700350	nonsense	probably null
R5034:Col12a1	UTSW	9	79657367	missense	probably damaging	1.00
R5133:Col12a1	UTSW	9	79605174	missense	probably damaging	0.99
R5138:Col12a1	UTSW	9	79643966	missense	probably damaging	1.00
R5145:Col12a1	UTSW	9	79706300	missense	probably benign	0.00
R5152:Col12a1	UTSW	9	79656748	missense	probably damaging	1.00
R5237:Col12a1	UTSW	9	79700262	missense	probably benign	0.00
R5268:Col12a1	UTSW	9	79678047	missense	probably damaging	0.99
R5372:Col12a1	UTSW	9	79678366	missense	probably damaging	1.00
R5440:Col12a1	UTSW	9	79614363	missense	probably benign	0.07
R5496:Col12a1	UTSW	9	79602185	splice site	probably benign
R5537:Col12a1	UTSW	9	79699590	missense	probably damaging	1.00
R5596:Col12a1	UTSW	9	79703759	missense	probably damaging	1.00
R5677:Col12a1	UTSW	9	79699321	missense	probably damaging	1.00
R5715:Col12a1	UTSW	9	79616065	nonsense	probably null
R5796:Col12a1	UTSW	9	79703829	missense	possibly damaging	0.73
R5829:Col12a1	UTSW	9	79633673	missense	probably damaging	1.00
R5865:Col12a1	UTSW	9	79604478	missense	probably benign	0.00
R5919:Col12a1	UTSW	9	79602298	missense	probably damaging	0.99
R5974:Col12a1	UTSW	9	79682127	missense	probably damaging	0.99
R5981:Col12a1	UTSW	9	79678506	missense	probably damaging	0.99
R5982:Col12a1	UTSW	9	79630560	missense	probably damaging	1.00
R6027:Col12a1	UTSW	9	79656578	critical splice donor site	probably null
R6090:Col12a1	UTSW	9	79692393	missense	probably damaging	1.00
R6293:Col12a1	UTSW	9	79614358	missense	probably benign	0.00
R6393:Col12a1	UTSW	9	79655485	missense	probably damaging	0.99
R6457:Col12a1	UTSW	9	79645691	missense	probably damaging	1.00
R6505:Col12a1	UTSW	9	79647605	missense	probably damaging	0.98
R6508:Col12a1	UTSW	9	79649949	missense	probably damaging	1.00
R6620:Col12a1	UTSW	9	79620049	missense	probably damaging	0.98
R6718:Col12a1	UTSW	9	79699605	missense	probably damaging	1.00
R6752:Col12a1	UTSW	9	79633424	missense	possibly damaging	0.72
R6774:Col12a1	UTSW	9	79706337	missense	possibly damaging	0.65
R6872:Col12a1	UTSW	9	79677234	missense	probably damaging	1.00
R6884:Col12a1	UTSW	9	79639809	missense	possibly damaging	0.92
R6935:Col12a1	UTSW	9	79700500	missense	possibly damaging	0.76
R7198:Col12a1	UTSW	9	79650032	missense	possibly damaging	0.56
R7296:Col12a1	UTSW	9	79682066	missense	probably damaging	1.00
R7365:Col12a1	UTSW	9	79706360	missense	probably damaging	0.99
R7466:Col12a1	UTSW	9	79655407	missense	possibly damaging	0.95
R7516:Col12a1	UTSW	9	79612910	splice site	probably null
R7584:Col12a1	UTSW	9	79703296	critical splice donor site	probably null
R7624:Col12a1	UTSW	9	79645794	splice site	probably null
R7670:Col12a1	UTSW	9	79631643	missense	probably damaging	1.00
R7678:Col12a1	UTSW	9	79651486	missense	probably damaging	0.99
R7702:Col12a1	UTSW	9	79681521	missense	probably damaging	1.00
R7796:Col12a1	UTSW	9	79678551	missense	possibly damaging	0.88
R7902:Col12a1	UTSW	9	79641581	missense	probably benign	0.00
R7923:Col12a1	UTSW	9	79678493	missense	probably benign	0.00
R7986:Col12a1	UTSW	9	79604392	critical splice donor site	probably null
R8004:Col12a1	UTSW	9	79684401	missense	probably damaging	1.00
R8046:Col12a1	UTSW	9	79706226	critical splice donor site	probably null
R8056:Col12a1	UTSW	9	79599938	missense
R8151:Col12a1	UTSW	9	79630549	missense	possibly damaging	0.62
R8203:Col12a1	UTSW	9	79681549	missense	possibly damaging	0.94
R8221:Col12a1	UTSW	9	79643942	missense	probably damaging	1.00
R8294:Col12a1	UTSW	9	79699312	missense	possibly damaging	0.91
R8309:Col12a1	UTSW	9	79605183	missense	possibly damaging	0.68
R8319:Col12a1	UTSW	9	79648697	missense	probably damaging	0.97
R8351:Col12a1	UTSW	9	79681412	missense	probably damaging	0.97
R8442:Col12a1	UTSW	9	79635499	missense	probably damaging	1.00
R8500:Col12a1	UTSW	9	79609851	missense	probably damaging	1.00
R8682:Col12a1	UTSW	9	79661076	missense	probably benign	0.03
R8700:Col12a1	UTSW	9	79620089	missense	probably benign	0.09
R8859:Col12a1	UTSW	9	79680399	nonsense	probably null
R8898:Col12a1	UTSW	9	79692295	missense	probably benign	0.08
R8930:Col12a1	UTSW	9	79673383	missense	probably benign
R8932:Col12a1	UTSW	9	79673383	missense	probably benign
R8949:Col12a1	UTSW	9	79674688	missense	probably benign	0.17
R8962:Col12a1	UTSW	9	79631619	missense	probably damaging	1.00
R9045:Col12a1	UTSW	9	79674752	missense	probably benign	0.00
R9080:Col12a1	UTSW	9	79609851	missense	probably benign	0.06
R9145:Col12a1	UTSW	9	79620062	missense	probably benign	0.16
R9163:Col12a1	UTSW	9	79641447	critical splice donor site	probably null
R9168:Col12a1	UTSW	9	79641501	nonsense	probably null
R9188:Col12a1	UTSW	9	79602332	missense	probably benign	0.22
R9258:Col12a1	UTSW	9	79706363	missense	probably benign	0.04
R9292:Col12a1	UTSW	9	79678523	missense	probably benign	0.33
R9345:Col12a1	UTSW	9	79633735	missense	probably benign	0.08
R9382:Col12a1	UTSW	9	79682082	missense	probably benign	0.23
R9427:Col12a1	UTSW	9	79682163	missense	probably benign	0.15
R9601:Col12a1	UTSW	9	79617752	missense	probably damaging	0.98
R9653:Col12a1	UTSW	9	79677274	missense	probably benign
R9668:Col12a1	UTSW	9	79639678	nonsense	probably null
R9762:Col12a1	UTSW	9	79619984	missense	possibly damaging	0.82
X0021:Col12a1	UTSW	9	79608485	missense	probably damaging	1.00
X0058:Col12a1	UTSW	9	79602224	missense	possibly damaging	0.66
X0061:Col12a1	UTSW	9	79612392	splice site	probably null
Z1177:Col12a1	UTSW	9	79599986	missense	possibly damaging	0.80
Z1177:Col12a1	UTSW	9	79639696	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CCTTACCATGAGGCGCTAAG -3'
(R):5'- AGACTCTTGACTTGGGATAAAATGG -3'

Sequencing Primer
(F):5'- TAAGCAGCAAAGGCCTCG -3'
(R):5'- ACAGTTTTTGTAATCAATCTGGGGC -3'

Posted On

2016-08-04