Incidental Mutation 'R0485:Myrip'
ID 42216
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Name myosin VIIA and Rab interacting protein
Synonyms A230081N12Rik, Slac2-c
MMRRC Submission 038684-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0485 (G1)
Quality Score 183
Status Validated
Chromosome 9
Chromosomal Location 120132996-120305167 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 120270443 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 564 (N564K)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
AlphaFold Q8K3I4
Predicted Effect probably benign
Transcript: ENSMUST00000048121
AA Change: N564K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: N564K

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 100% (95/95)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik A G 16: 3,725,511 (GRCm39) V5A probably damaging Het
Abi3bp A G 16: 56,424,375 (GRCm39) probably null Het
Acot11 G A 4: 106,619,224 (GRCm39) R184C probably damaging Het
Adgre5 A T 8: 84,458,627 (GRCm39) I133N probably damaging Het
Afap1 A T 5: 36,108,347 (GRCm39) Q231L probably damaging Het
Alg12 T C 15: 88,695,630 (GRCm39) T289A probably benign Het
Ank3 T A 10: 69,718,374 (GRCm39) S542T possibly damaging Het
Ankmy2 G A 12: 36,232,389 (GRCm39) R138Q possibly damaging Het
Ascc2 C T 11: 4,622,302 (GRCm39) A456V probably benign Het
Atg4c G A 4: 99,112,719 (GRCm39) V289I probably benign Het
Bbs7 A T 3: 36,657,022 (GRCm39) Y269N probably damaging Het
Bcas3 T A 11: 85,386,676 (GRCm39) D370E probably damaging Het
Bicc1 T G 10: 70,761,145 (GRCm39) E955A probably damaging Het
Bok T C 1: 93,616,999 (GRCm39) F115S probably damaging Het
Caap1 A T 4: 94,438,758 (GRCm39) probably null Het
Cacna2d3 T A 14: 29,256,476 (GRCm39) M95L possibly damaging Het
Calcrl T A 2: 84,200,435 (GRCm39) D115V probably benign Het
Car7 A T 8: 105,270,170 (GRCm39) M57L probably benign Het
Casq1 G T 1: 172,037,957 (GRCm39) probably benign Het
Cep290 A T 10: 100,385,206 (GRCm39) D1894V possibly damaging Het
Clec4a2 T A 6: 123,100,588 (GRCm39) N14K probably damaging Het
Col16a1 G T 4: 129,984,290 (GRCm39) probably benign Het
Col5a1 T C 2: 27,880,109 (GRCm39) probably benign Het
Col5a2 A T 1: 45,417,642 (GRCm39) I1311N probably damaging Het
Col5a3 T C 9: 20,694,004 (GRCm39) T1050A probably damaging Het
Colgalt2 A T 1: 152,360,622 (GRCm39) I220F probably damaging Het
Cpb1 A T 3: 20,329,792 (GRCm39) V8E unknown Het
Dchs1 C T 7: 105,421,934 (GRCm39) R162H probably benign Het
Dhx37 A G 5: 125,499,295 (GRCm39) Y638H probably benign Het
Dhx40 T G 11: 86,662,088 (GRCm39) probably benign Het
Ehd2 T A 7: 15,686,001 (GRCm39) Q357L probably benign Het
Ewsr1 T C 11: 5,020,737 (GRCm39) probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Gid8 T A 2: 180,355,004 (GRCm39) Y3* probably null Het
Gm10212 A C 19: 11,548,174 (GRCm39) noncoding transcript Het
Grin3b T A 10: 79,809,890 (GRCm39) N465K possibly damaging Het
H1f3 A T 13: 23,739,924 (GRCm39) K221* probably null Het
Htr4 A T 18: 62,561,225 (GRCm39) N162I probably damaging Het
Irag2 T C 6: 145,110,938 (GRCm39) C248R probably damaging Het
Itga3 T C 11: 94,952,796 (GRCm39) D325G probably benign Het
Itpr3 T G 17: 27,330,903 (GRCm39) V1737G probably damaging Het
Kcnab2 C T 4: 152,479,439 (GRCm39) V251I probably benign Het
Kcnn2 A T 18: 45,693,215 (GRCm39) I264L probably benign Het
Klhl41 T C 2: 69,501,600 (GRCm39) Y354H probably damaging Het
Klra6 T C 6: 130,000,601 (GRCm39) I68V probably benign Het
Letm2 G T 8: 26,082,574 (GRCm39) P178Q probably damaging Het
Lypd11 C A 7: 24,422,170 (GRCm39) C193F possibly damaging Het
Mbtps1 A T 8: 120,249,340 (GRCm39) probably benign Het
Mecom C T 3: 30,035,121 (GRCm39) probably benign Het
Mrps5 T A 2: 127,433,745 (GRCm39) S45T possibly damaging Het
Msra T A 14: 64,678,210 (GRCm39) I29F possibly damaging Het
Mup5 T C 4: 61,751,229 (GRCm39) probably null Het
Myo1a T C 10: 127,555,111 (GRCm39) probably benign Het
Naa20 T A 2: 145,757,592 (GRCm39) D148E probably damaging Het
Naga T G 15: 82,220,956 (GRCm39) probably benign Het
Npc1 A G 18: 12,346,503 (GRCm39) V231A probably benign Het
Nphs1 T C 7: 30,166,940 (GRCm39) F716L probably benign Het
Or8s5 T C 15: 98,238,810 (GRCm39) H20R probably benign Het
Parn G C 16: 13,472,299 (GRCm39) probably benign Het
Polk A T 13: 96,620,272 (GRCm39) C664S probably benign Het
Prkar2b A G 12: 32,026,034 (GRCm39) probably benign Het
Prkdc A G 16: 15,651,604 (GRCm39) E3747G probably damaging Het
Prmt5 A T 14: 54,748,712 (GRCm39) M362K probably damaging Het
Prob1 T C 18: 35,786,878 (GRCm39) T459A possibly damaging Het
Rttn C T 18: 89,108,543 (GRCm39) probably benign Het
Scn1a T C 2: 66,104,269 (GRCm39) M1664V probably damaging Het
Sez6 T A 11: 77,844,639 (GRCm39) L154H probably damaging Het
Sh3tc1 A G 5: 35,859,356 (GRCm39) probably benign Het
Shkbp1 C T 7: 27,048,006 (GRCm39) G334D probably damaging Het
Slc8a1 A T 17: 81,955,422 (GRCm39) F539I probably damaging Het
Spata31e5 G T 1: 28,817,223 (GRCm39) Q270K probably damaging Het
Sptan1 T C 2: 29,903,860 (GRCm39) probably benign Het
Ssc5d C T 7: 4,940,470 (GRCm39) T861M probably damaging Het
Tbx5 A T 5: 120,021,523 (GRCm39) M510L probably benign Het
Tdp1 A G 12: 99,876,101 (GRCm39) T351A probably benign Het
Tmc8 T A 11: 117,682,904 (GRCm39) probably benign Het
Tmco5 T A 2: 116,720,588 (GRCm39) D205E probably benign Het
Tmprss2 T C 16: 97,373,194 (GRCm39) probably benign Het
Top6bl A T 19: 4,708,442 (GRCm39) I350N probably damaging Het
Tph1 T A 7: 46,299,448 (GRCm39) K364N probably benign Het
Trim24 T C 6: 37,934,001 (GRCm39) L648P probably damaging Het
Trmt6 C A 2: 132,650,950 (GRCm39) probably benign Het
Ube2i A T 17: 25,488,259 (GRCm39) probably benign Het
Vcan A C 13: 89,852,779 (GRCm39) L727R possibly damaging Het
Vmn2r28 T C 7: 5,491,689 (GRCm39) Y186C probably damaging Het
Wars1 C A 12: 108,841,083 (GRCm39) D232Y probably damaging Het
Xrcc5 T C 1: 72,378,104 (GRCm39) probably benign Het
Zbtb24 T A 10: 41,340,532 (GRCm39) S543T probably damaging Het
Zfp91 A G 19: 12,753,353 (GRCm39) probably benign Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120,217,330 (GRCm39) missense probably damaging 1.00
IGL02108:Myrip APN 9 120,296,631 (GRCm39) critical splice donor site probably null
IGL02406:Myrip APN 9 120,296,598 (GRCm39) missense probably benign
IGL02876:Myrip APN 9 120,261,740 (GRCm39) missense probably damaging 1.00
IGL03109:Myrip APN 9 120,282,790 (GRCm39) splice site probably null
IGL03258:Myrip APN 9 120,270,418 (GRCm39) missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120,296,583 (GRCm39) missense probably damaging 0.98
R0633:Myrip UTSW 9 120,217,302 (GRCm39) missense probably damaging 1.00
R1489:Myrip UTSW 9 120,261,595 (GRCm39) missense probably damaging 1.00
R1539:Myrip UTSW 9 120,253,689 (GRCm39) missense probably benign 0.00
R1708:Myrip UTSW 9 120,293,840 (GRCm39) missense possibly damaging 0.65
R1817:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1818:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1878:Myrip UTSW 9 120,253,721 (GRCm39) missense probably damaging 0.99
R2484:Myrip UTSW 9 120,253,685 (GRCm39) missense probably benign 0.00
R3237:Myrip UTSW 9 120,270,473 (GRCm39) missense possibly damaging 0.91
R3890:Myrip UTSW 9 120,251,324 (GRCm39) missense probably damaging 1.00
R3912:Myrip UTSW 9 120,261,682 (GRCm39) missense probably benign
R3919:Myrip UTSW 9 120,261,695 (GRCm39) missense probably damaging 1.00
R4125:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4126:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4128:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4435:Myrip UTSW 9 120,164,680 (GRCm39) start gained probably benign
R4599:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
R5014:Myrip UTSW 9 120,251,534 (GRCm39) missense probably damaging 1.00
R5665:Myrip UTSW 9 120,290,499 (GRCm39) missense probably damaging 1.00
R5814:Myrip UTSW 9 120,253,734 (GRCm39) missense probably benign 0.06
R5849:Myrip UTSW 9 120,282,759 (GRCm39) missense probably damaging 0.99
R5986:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R6706:Myrip UTSW 9 120,217,359 (GRCm39) missense possibly damaging 0.93
R7019:Myrip UTSW 9 120,251,573 (GRCm39) missense probably damaging 1.00
R7291:Myrip UTSW 9 120,246,207 (GRCm39) missense probably damaging 0.97
R8204:Myrip UTSW 9 120,262,045 (GRCm39) critical splice donor site probably null
R8557:Myrip UTSW 9 120,246,252 (GRCm39) missense probably benign 0.32
R8853:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R8911:Myrip UTSW 9 120,270,484 (GRCm39) missense possibly damaging 0.94
R9106:Myrip UTSW 9 120,261,544 (GRCm39) missense probably benign 0.37
R9225:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
Z1177:Myrip UTSW 9 120,270,547 (GRCm39) missense probably damaging 1.00
Z1177:Myrip UTSW 9 120,261,844 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGAAAGACTTGCTGTTGCCCTG -3'
(R):5'- TCCCAAGCACATTGAGGGGAAAGC -3'

Sequencing Primer
(F):5'- GCCCTGGGCTTCCTTAC -3'
(R):5'- CCTGGTTGTTCTCCTCAGAAGAG -3'
Posted On 2013-05-23