Incidental Mutation 'R5328:Pfas'
ID 422160
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Name phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms 4432409B16Rik, Sofa
MMRRC Submission 042843-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5328 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 68876527-68899286 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68879418 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1160 (C1160S)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
AlphaFold Q5SUR0
Predicted Effect probably damaging
Transcript: ENSMUST00000021282
AA Change: C1160S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: C1160S

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146490
Predicted Effect probably benign
Transcript: ENSMUST00000149703
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152964
AA Change: C264S
SMART Domains Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899
AA Change: C264S

DomainStartEndE-ValueType
Pfam:AIRS_C 2 94 1.6e-12 PFAM
GATase_5 166 468 6.88e-120 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174986
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,887,694 (GRCm39) V860E possibly damaging Het
Abcc6 T C 7: 45,641,735 (GRCm39) D881G probably benign Het
Abcc9 A G 6: 142,627,785 (GRCm39) V415A probably benign Het
Adgrb3 A C 1: 25,133,356 (GRCm39) N1003K possibly damaging Het
Adora3 C T 3: 105,814,619 (GRCm39) T123I probably benign Het
Amotl2 A C 9: 102,600,967 (GRCm39) T345P probably benign Het
Arap3 C T 18: 38,124,740 (GRCm39) E247K possibly damaging Het
Atp8b1 A T 18: 64,664,462 (GRCm39) D1235E probably benign Het
Axl A T 7: 25,472,836 (GRCm39) V400E probably damaging Het
Brd8 T A 18: 34,741,034 (GRCm39) N431Y probably benign Het
Cadps A T 14: 12,457,790 (GRCm38) N1025K probably benign Het
Cblc A T 7: 19,526,505 (GRCm39) S195T possibly damaging Het
Chd2 C T 7: 73,113,429 (GRCm39) A1184T possibly damaging Het
Chst10 G A 1: 38,935,043 (GRCm39) probably benign Het
Col12a1 T C 9: 79,527,342 (GRCm39) K2663E probably damaging Het
Cspg4 A T 9: 56,793,140 (GRCm39) I292L probably benign Het
Cul1 T C 6: 47,485,251 (GRCm39) V294A probably damaging Het
Cyp2d11 G A 15: 82,275,972 (GRCm39) P203L probably benign Het
Dnaaf10 C A 11: 17,172,220 (GRCm39) P103Q probably damaging Het
Dscam T C 16: 96,474,878 (GRCm39) H1228R probably benign Het
Eif3l A T 15: 78,977,561 (GRCm39) K534* probably null Het
Enpep T C 3: 129,074,159 (GRCm39) E796G probably benign Het
Ext1 C A 15: 52,939,213 (GRCm39) W612L probably damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fam117a T A 11: 95,254,996 (GRCm39) probably null Het
Fan1 A T 7: 64,004,217 (GRCm39) Y750N probably damaging Het
Fat4 T A 3: 39,011,017 (GRCm39) I2039N probably damaging Het
Gabrr2 G T 4: 33,082,565 (GRCm39) D106Y probably damaging Het
Gak A C 5: 108,764,867 (GRCm39) C145G possibly damaging Het
Galnt14 A T 17: 73,812,454 (GRCm39) N406K possibly damaging Het
Gm10439 T G X: 148,419,159 (GRCm39) *434E probably null Het
Gm10837 G T 14: 122,728,190 (GRCm39) R22L unknown Het
Gm19965 T A 1: 116,749,148 (GRCm39) H276Q possibly damaging Het
Gm43517 T C 12: 49,437,939 (GRCm39) probably benign Het
Greb1l A T 18: 10,553,720 (GRCm39) I1574F probably damaging Het
Gzme G A 14: 56,355,224 (GRCm39) H236Y probably benign Het
Heatr5b G A 17: 79,133,791 (GRCm39) T266I possibly damaging Het
Hk3 T C 13: 55,161,306 (GRCm39) I185V probably benign Het
Hnrnpr A G 4: 136,066,527 (GRCm39) E302G probably benign Het
Itgal T C 7: 126,910,847 (GRCm39) probably null Het
Itk A G 11: 46,222,703 (GRCm39) S583P probably benign Het
Loxhd1 A T 18: 77,498,268 (GRCm39) I1448F probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,244,784 (GRCm39) probably null Het
Man2a2 A T 7: 80,018,504 (GRCm39) F118L probably benign Het
Mfsd5 T A 15: 102,189,447 (GRCm39) V273E probably damaging Het
Nfe2l2 A G 2: 75,507,200 (GRCm39) L300P probably damaging Het
Nt5c1a T G 4: 123,102,786 (GRCm39) L122R possibly damaging Het
Nt5c3b A G 11: 100,331,067 (GRCm39) F42S probably damaging Het
Or2av9 C A 11: 58,381,255 (GRCm39) A109S possibly damaging Het
Or51g2 T A 7: 102,623,175 (GRCm39) N8I possibly damaging Het
Pabpc1 A T 15: 36,603,121 (GRCm39) D204E probably benign Het
Panx2 A G 15: 88,952,298 (GRCm39) N255S probably damaging Het
Pcnt A G 10: 76,247,553 (GRCm39) L993P probably damaging Het
Plekhh3 T A 11: 101,058,484 (GRCm39) probably benign Het
Plod3 T A 5: 137,018,537 (GRCm39) N258K probably damaging Het
Prr14l T C 5: 32,987,365 (GRCm39) Q710R probably benign Het
Rnf216 G T 5: 143,078,754 (GRCm39) T65K possibly damaging Het
Samd9l T C 6: 3,376,739 (GRCm39) E174G probably damaging Het
Septin12 T A 16: 4,811,857 (GRCm39) M63L possibly damaging Het
Sh3bgrl2 T A 9: 83,459,509 (GRCm39) D22E probably benign Het
Sirpd T C 3: 15,397,234 (GRCm39) M17V unknown Het
Skil A G 3: 31,171,718 (GRCm39) K488R probably benign Het
Slamf6 T A 1: 171,765,662 (GRCm39) I262K probably benign Het
Slc27a3 T C 3: 90,294,139 (GRCm39) D470G probably damaging Het
Sorbs3 A T 14: 70,418,623 (GRCm39) V680E probably damaging Het
Sox9 C T 11: 112,673,484 (GRCm39) T25I probably benign Het
Srsf1 G T 11: 87,940,819 (GRCm39) probably benign Het
Stard9 A C 2: 120,529,711 (GRCm39) E1989D probably damaging Het
Thumpd2 T A 17: 81,351,591 (GRCm39) I277F possibly damaging Het
Tinag C A 9: 76,912,913 (GRCm39) G299* probably null Het
Tk2 A T 8: 104,955,931 (GRCm39) probably null Het
Tmem44 A G 16: 30,359,709 (GRCm39) S210P possibly damaging Het
Traf3ip1 C A 1: 91,447,791 (GRCm39) P423T probably damaging Het
Trmt12 A G 15: 58,744,704 (GRCm39) D34G probably damaging Het
Ttc39b A G 4: 83,180,178 (GRCm39) Y72H probably damaging Het
Ttn G A 2: 76,708,755 (GRCm39) probably benign Het
Ttyh2 T A 11: 114,600,894 (GRCm39) I381N possibly damaging Het
Uaca A T 9: 60,777,814 (GRCm39) N734Y probably benign Het
Usp34 T C 11: 23,414,616 (GRCm39) I2853T probably benign Het
Usp34 G A 11: 23,438,659 (GRCm39) G3407D probably benign Het
Vmn2r78 A G 7: 86,570,238 (GRCm39) Y252C probably damaging Het
Wdr19 G A 5: 65,401,522 (GRCm39) C979Y probably damaging Het
Yeats2 A T 16: 19,989,955 (GRCm39) H277L probably damaging Het
Zbtb2 T C 10: 4,319,267 (GRCm39) Y253C possibly damaging Het
Zfat C A 15: 68,051,677 (GRCm39) G706C probably damaging Het
Zfp106 A T 2: 120,350,898 (GRCm39) N1584K possibly damaging Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 68,894,640 (GRCm39) nonsense probably null
IGL01287:Pfas APN 11 68,892,086 (GRCm39) missense probably benign 0.09
IGL01712:Pfas APN 11 68,881,886 (GRCm39) missense probably benign 0.34
IGL02019:Pfas APN 11 68,884,289 (GRCm39) unclassified probably benign
IGL02053:Pfas APN 11 68,883,779 (GRCm39) missense probably damaging 1.00
IGL02718:Pfas APN 11 68,890,971 (GRCm39) splice site probably benign
IGL02801:Pfas APN 11 68,879,103 (GRCm39) unclassified probably benign
Surf UTSW 11 68,878,847 (GRCm39) missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68,880,862 (GRCm39) missense
R0037:Pfas UTSW 11 68,890,862 (GRCm39) missense probably damaging 1.00
R0046:Pfas UTSW 11 68,881,293 (GRCm39) missense probably benign
R0046:Pfas UTSW 11 68,881,293 (GRCm39) missense probably benign
R0408:Pfas UTSW 11 68,891,931 (GRCm39) critical splice donor site probably null
R0532:Pfas UTSW 11 68,893,455 (GRCm39) splice site probably benign
R0707:Pfas UTSW 11 68,888,863 (GRCm39) missense probably benign 0.00
R0783:Pfas UTSW 11 68,891,347 (GRCm39) missense probably damaging 1.00
R0946:Pfas UTSW 11 68,881,573 (GRCm39) splice site probably null
R0946:Pfas UTSW 11 68,884,121 (GRCm39) critical splice donor site probably null
R1470:Pfas UTSW 11 68,882,185 (GRCm39) missense probably benign
R1470:Pfas UTSW 11 68,882,185 (GRCm39) missense probably benign
R1507:Pfas UTSW 11 68,880,860 (GRCm39) missense probably benign 0.06
R1699:Pfas UTSW 11 68,888,872 (GRCm39) critical splice acceptor site probably null
R1870:Pfas UTSW 11 68,882,795 (GRCm39) missense probably damaging 1.00
R1871:Pfas UTSW 11 68,882,795 (GRCm39) missense probably damaging 1.00
R1959:Pfas UTSW 11 68,885,110 (GRCm39) missense probably damaging 1.00
R2026:Pfas UTSW 11 68,884,783 (GRCm39) missense probably damaging 1.00
R2180:Pfas UTSW 11 68,883,013 (GRCm39) missense possibly damaging 0.92
R3808:Pfas UTSW 11 68,880,779 (GRCm39) intron probably benign
R3809:Pfas UTSW 11 68,880,779 (GRCm39) intron probably benign
R3872:Pfas UTSW 11 68,891,089 (GRCm39) missense probably damaging 1.00
R3906:Pfas UTSW 11 68,879,112 (GRCm39) unclassified probably benign
R4092:Pfas UTSW 11 68,884,775 (GRCm39) missense probably benign
R4437:Pfas UTSW 11 68,879,243 (GRCm39) missense probably damaging 1.00
R4599:Pfas UTSW 11 68,881,895 (GRCm39) missense probably benign 0.15
R4763:Pfas UTSW 11 68,881,020 (GRCm39) missense possibly damaging 0.81
R5116:Pfas UTSW 11 68,881,816 (GRCm39) intron probably benign
R5310:Pfas UTSW 11 68,878,847 (GRCm39) missense probably damaging 1.00
R5351:Pfas UTSW 11 68,882,217 (GRCm39) missense probably damaging 1.00
R5427:Pfas UTSW 11 68,891,979 (GRCm39) missense possibly damaging 0.90
R5533:Pfas UTSW 11 68,882,296 (GRCm39) missense probably benign 0.02
R5602:Pfas UTSW 11 68,881,871 (GRCm39) missense probably benign 0.05
R5637:Pfas UTSW 11 68,884,149 (GRCm39) missense probably damaging 1.00
R5645:Pfas UTSW 11 68,881,958 (GRCm39) missense probably damaging 1.00
R6149:Pfas UTSW 11 68,882,771 (GRCm39) missense probably benign 0.07
R6295:Pfas UTSW 11 68,888,825 (GRCm39) missense probably benign 0.36
R6305:Pfas UTSW 11 68,892,023 (GRCm39) missense possibly damaging 0.51
R6387:Pfas UTSW 11 68,891,291 (GRCm39) missense probably damaging 1.00
R6425:Pfas UTSW 11 68,881,897 (GRCm39) missense probably benign 0.17
R6523:Pfas UTSW 11 68,881,283 (GRCm39) missense probably benign
R6914:Pfas UTSW 11 68,883,007 (GRCm39) missense probably benign 0.01
R6915:Pfas UTSW 11 68,883,007 (GRCm39) missense probably benign 0.01
R6945:Pfas UTSW 11 68,891,356 (GRCm39) missense probably benign
R6957:Pfas UTSW 11 68,884,709 (GRCm39) missense probably benign 0.14
R7025:Pfas UTSW 11 68,881,586 (GRCm39) missense probably benign 0.01
R7257:Pfas UTSW 11 68,883,785 (GRCm39) missense probably damaging 1.00
R7386:Pfas UTSW 11 68,894,600 (GRCm39) missense probably benign
R7424:Pfas UTSW 11 68,890,918 (GRCm39) missense probably damaging 1.00
R7459:Pfas UTSW 11 68,879,481 (GRCm39) missense
R7593:Pfas UTSW 11 68,881,921 (GRCm39) missense
R7731:Pfas UTSW 11 68,890,871 (GRCm39) missense probably damaging 1.00
R8103:Pfas UTSW 11 68,883,119 (GRCm39) missense probably damaging 0.98
R8248:Pfas UTSW 11 68,891,089 (GRCm39) missense probably damaging 1.00
R8804:Pfas UTSW 11 68,881,908 (GRCm39) missense
R8853:Pfas UTSW 11 68,883,744 (GRCm39) missense probably damaging 1.00
R9032:Pfas UTSW 11 68,879,421 (GRCm39) missense
R9050:Pfas UTSW 11 68,882,567 (GRCm39) missense probably benign 0.01
R9283:Pfas UTSW 11 68,884,708 (GRCm39) missense probably damaging 1.00
R9644:Pfas UTSW 11 68,883,542 (GRCm39) missense probably benign 0.23
Z1176:Pfas UTSW 11 68,893,313 (GRCm39) missense probably damaging 1.00
Z1176:Pfas UTSW 11 68,880,896 (GRCm39) missense
Z1177:Pfas UTSW 11 68,893,319 (GRCm39) nonsense probably null
Z1177:Pfas UTSW 11 68,881,051 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCATCCCTCGGAGCATCAG -3'
(R):5'- AGGGCTGTCATGTCATTCCC -3'

Sequencing Primer
(F):5'- TCGGAGCATCAGGGCTG -3'
(R):5'- AGATGAGCGCCTCAGATTTC -3'
Posted On 2016-08-04