Mutagenetix > Incidental Mutation

Incidental Mutation 'R5328:Pfas'

422160

Institutional Source

Beutler Lab

Gene Symbol

Pfas

Ensembl Gene

ENSMUSG00000020899

Gene Name

phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)

Synonyms

4432409B16Rik, Sofa

MMRRC Submission

042843-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5328 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

68985697-69008460 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68988592 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1160 (C1160S)

Ref Sequence

ENSEMBL: ENSMUSP00000021282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021282]

AlphaFold

Q5SUR0

Predicted Effect

probably damaging
Transcript: ENSMUST00000021282
AA Change: C1160S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: C1160S

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	444	603	1.7e-21	PFAM
low complexity region	615	632	N/A	INTRINSIC
low complexity region	786	798	N/A	INTRINSIC
Pfam:AIRS_C	853	988	3e-11	PFAM
GATase_5	1061	1332	8.38e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146490

Predicted Effect

probably benign
Transcript: ENSMUST00000149703

SMART Domains

Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	3	110	4e-12	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000152964
AA Change: C264S

SMART Domains

Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899
AA Change: C264S

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	2	94	1.6e-12	PFAM
GATase_5	166	468	6.88e-120	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172915

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174986

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,837,694	V860E	possibly damaging	Het
Abcc6	T	C	7: 45,992,311	D881G	probably benign	Het
Abcc9	A	G	6: 142,682,059	V415A	probably benign	Het
Adgrb3	A	C	1: 25,094,275	N1003K	possibly damaging	Het
Adora3	C	T	3: 105,907,303	T123I	probably benign	Het
Amotl2	A	C	9: 102,723,768	T345P	probably benign	Het
Arap3	C	T	18: 37,991,687	E247K	possibly damaging	Het
Atp8b1	A	T	18: 64,531,391	D1235E	probably benign	Het
Axl	A	T	7: 25,773,411	V400E	probably damaging	Het
Brd8	T	A	18: 34,607,981	N431Y	probably benign	Het
Cadps	A	T	14: 12,457,790	N1025K	probably benign	Het
Cblc	A	T	7: 19,792,580	S195T	possibly damaging	Het
Chd2	C	T	7: 73,463,681	A1184T	possibly damaging	Het
Chst10	G	A	1: 38,895,962		probably benign	Het
Col12a1	T	C	9: 79,620,060	K2663E	probably damaging	Het
Cspg4	A	T	9: 56,885,856	I292L	probably benign	Het
Cul1	T	C	6: 47,508,317	V294A	probably damaging	Het
Cyp2d11	G	A	15: 82,391,771	P203L	probably benign	Het
Dscam	T	C	16: 96,673,678	H1228R	probably benign	Het
Eif3l	A	T	15: 79,093,361	K534*	probably null	Het
Enpep	T	C	3: 129,280,510	E796G	probably benign	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam117a	T	A	11: 95,364,170		probably null	Het
Fan1	A	T	7: 64,354,469	Y750N	probably damaging	Het
Fat4	T	A	3: 38,956,868	I2039N	probably damaging	Het
Gabrr2	G	T	4: 33,082,565	D106Y	probably damaging	Het
Gak	A	C	5: 108,617,001	C145G	possibly damaging	Het
Galnt14	A	T	17: 73,505,459	N406K	possibly damaging	Het
Gm10439	T	G	X: 149,636,163	*434E	probably null	Het
Gm10837	G	T	14: 122,490,778	R22L	unknown	Het
Gm19965	T	A	1: 116,821,418	H276Q	possibly damaging	Het
Gm43517	T	C	12: 49,391,156		probably benign	Het
Gm9733	T	C	3: 15,332,174	M17V	unknown	Het
Greb1l	A	T	18: 10,553,720	I1574F	probably damaging	Het
Gzme	G	A	14: 56,117,767	H236Y	probably benign	Het
Heatr5b	G	A	17: 78,826,362	T266I	possibly damaging	Het
Hk3	T	C	13: 55,013,493	I185V	probably benign	Het
Hnrnpr	A	G	4: 136,339,216	E302G	probably benign	Het
Itgal	T	C	7: 127,311,675		probably null	Het
Itk	A	G	11: 46,331,876	S583P	probably benign	Het
Loxhd1	A	T	18: 77,410,572	I1448F	probably damaging	Het
Macf1	GCCCCC	GCCCCCC	4: 123,350,991		probably null	Het
Man2a2	A	T	7: 80,368,756	F118L	probably benign	Het
Mfsd5	T	A	15: 102,281,012	V273E	probably damaging	Het
Nfe2l2	A	G	2: 75,676,856	L300P	probably damaging	Het
Nt5c1a	T	G	4: 123,208,993	L122R	possibly damaging	Het
Nt5c3b	A	G	11: 100,440,241	F42S	probably damaging	Het
Olfr332	C	A	11: 58,490,429	A109S	possibly damaging	Het
Olfr577	T	A	7: 102,973,968	N8I	possibly damaging	Het
Pabpc1	A	T	15: 36,602,877	D204E	probably benign	Het
Panx2	A	G	15: 89,068,095	N255S	probably damaging	Het
Pcnt	A	G	10: 76,411,719	L993P	probably damaging	Het
Plekhh3	T	A	11: 101,167,658		probably benign	Het
Plod3	T	A	5: 136,989,683	N258K	probably damaging	Het
Prr14l	T	C	5: 32,830,021	Q710R	probably benign	Het
Rnf216	G	T	5: 143,092,999	T65K	possibly damaging	Het
Samd9l	T	C	6: 3,376,739	E174G	probably damaging	Het
Sept12	T	A	16: 4,993,993	M63L	possibly damaging	Het
Sh3bgrl2	T	A	9: 83,577,456	D22E	probably benign	Het
Skil	A	G	3: 31,117,569	K488R	probably benign	Het
Slamf6	T	A	1: 171,938,095	I262K	probably benign	Het
Slc27a3	T	C	3: 90,386,832	D470G	probably damaging	Het
Sorbs3	A	T	14: 70,181,174	V680E	probably damaging	Het
Sox9	C	T	11: 112,782,658	T25I	probably benign	Het
Srsf1	G	T	11: 88,049,993		probably benign	Het
Stard9	A	C	2: 120,699,230	E1989D	probably damaging	Het
Thumpd2	T	A	17: 81,044,162	I277F	possibly damaging	Het
Tinag	C	A	9: 77,005,631	G299*	probably null	Het
Tk2	A	T	8: 104,229,299		probably null	Het
Tmem44	A	G	16: 30,540,891	S210P	possibly damaging	Het
Traf3ip1	C	A	1: 91,520,069	P423T	probably damaging	Het
Trmt12	A	G	15: 58,872,855	D34G	probably damaging	Het
Ttc39b	A	G	4: 83,261,941	Y72H	probably damaging	Het
Ttn	G	A	2: 76,878,411		probably benign	Het
Ttyh2	T	A	11: 114,710,068	I381N	possibly damaging	Het
Uaca	A	T	9: 60,870,532	N734Y	probably benign	Het
Usp34	T	C	11: 23,464,616	I2853T	probably benign	Het
Usp34	G	A	11: 23,488,659	G3407D	probably benign	Het
Vmn2r78	A	G	7: 86,921,030	Y252C	probably damaging	Het
Wdr19	G	A	5: 65,244,179	C979Y	probably damaging	Het
Wdr92	C	A	11: 17,222,220	P103Q	probably damaging	Het
Yeats2	A	T	16: 20,171,205	H277L	probably damaging	Het
Zbtb2	T	C	10: 4,369,267	Y253C	possibly damaging	Het
Zfat	C	A	15: 68,179,828	G706C	probably damaging	Het
Zfp106	A	T	2: 120,520,417	N1584K	possibly damaging	Het

Other mutations in Pfas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Pfas	APN	11	69003814	nonsense	probably null
IGL01287:Pfas	APN	11	69001260	missense	probably benign	0.09
IGL01712:Pfas	APN	11	68991060	missense	probably benign	0.34
IGL02019:Pfas	APN	11	68993463	unclassified	probably benign
IGL02053:Pfas	APN	11	68992953	missense	probably damaging	1.00
IGL02718:Pfas	APN	11	69000145	splice site	probably benign
IGL02801:Pfas	APN	11	68988277	unclassified	probably benign
Surf	UTSW	11	68988021	missense	probably damaging	1.00
PIT4812001:Pfas	UTSW	11	68990036	missense
R0037:Pfas	UTSW	11	69000036	missense	probably damaging	1.00
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0408:Pfas	UTSW	11	69001105	critical splice donor site	probably null
R0532:Pfas	UTSW	11	69002629	splice site	probably benign
R0707:Pfas	UTSW	11	68998037	missense	probably benign	0.00
R0783:Pfas	UTSW	11	69000521	missense	probably damaging	1.00
R0946:Pfas	UTSW	11	68993295	critical splice donor site	probably null
R0946:Pfas	UTSW	11	68990747	splice site	probably null
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1507:Pfas	UTSW	11	68990034	missense	probably benign	0.06
R1699:Pfas	UTSW	11	68998046	critical splice acceptor site	probably null
R1870:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1871:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1959:Pfas	UTSW	11	68994284	missense	probably damaging	1.00
R2026:Pfas	UTSW	11	68993957	missense	probably damaging	1.00
R2180:Pfas	UTSW	11	68992187	missense	possibly damaging	0.92
R3808:Pfas	UTSW	11	68989953	intron	probably benign
R3809:Pfas	UTSW	11	68989953	intron	probably benign
R3872:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R3906:Pfas	UTSW	11	68988286	unclassified	probably benign
R4092:Pfas	UTSW	11	68993949	missense	probably benign
R4437:Pfas	UTSW	11	68988417	missense	probably damaging	1.00
R4599:Pfas	UTSW	11	68991069	missense	probably benign	0.15
R4763:Pfas	UTSW	11	68990194	missense	possibly damaging	0.81
R5116:Pfas	UTSW	11	68990990	intron	probably benign
R5310:Pfas	UTSW	11	68988021	missense	probably damaging	1.00
R5351:Pfas	UTSW	11	68991391	missense	probably damaging	1.00
R5427:Pfas	UTSW	11	69001153	missense	possibly damaging	0.90
R5533:Pfas	UTSW	11	68991470	missense	probably benign	0.02
R5602:Pfas	UTSW	11	68991045	missense	probably benign	0.05
R5637:Pfas	UTSW	11	68993323	missense	probably damaging	1.00
R5645:Pfas	UTSW	11	68991132	missense	probably damaging	1.00
R6149:Pfas	UTSW	11	68991945	missense	probably benign	0.07
R6295:Pfas	UTSW	11	68997999	missense	probably benign	0.36
R6305:Pfas	UTSW	11	69001197	missense	possibly damaging	0.51
R6387:Pfas	UTSW	11	69000465	missense	probably damaging	1.00
R6425:Pfas	UTSW	11	68991071	missense	probably benign	0.17
R6523:Pfas	UTSW	11	68990457	missense	probably benign
R6914:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6915:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6945:Pfas	UTSW	11	69000530	missense	probably benign
R6957:Pfas	UTSW	11	68993883	missense	probably benign	0.14
R7025:Pfas	UTSW	11	68990760	missense	probably benign	0.01
R7257:Pfas	UTSW	11	68992959	missense	probably damaging	1.00
R7386:Pfas	UTSW	11	69003774	missense	probably benign
R7424:Pfas	UTSW	11	69000092	missense	probably damaging	1.00
R7459:Pfas	UTSW	11	68988655	missense
R7593:Pfas	UTSW	11	68991095	missense
R7731:Pfas	UTSW	11	69000045	missense	probably damaging	1.00
R8103:Pfas	UTSW	11	68992293	missense	probably damaging	0.98
R8248:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R8804:Pfas	UTSW	11	68991082	missense
R8853:Pfas	UTSW	11	68992918	missense	probably damaging	1.00
R9032:Pfas	UTSW	11	68988595	missense
R9050:Pfas	UTSW	11	68991741	missense	probably benign	0.01
R9283:Pfas	UTSW	11	68993882	missense	probably damaging	1.00
R9644:Pfas	UTSW	11	68992716	missense	probably benign	0.23
Z1176:Pfas	UTSW	11	68990070	missense
Z1176:Pfas	UTSW	11	69002487	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	68990225	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	69002493	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTCCATCCCTCGGAGCATCAG -3'
(R):5'- AGGGCTGTCATGTCATTCCC -3'

Sequencing Primer
(F):5'- TCGGAGCATCAGGGCTG -3'
(R):5'- AGATGAGCGCCTCAGATTTC -3'

Posted On

2016-08-04