Incidental Mutation 'R5328:Faap100'
ID422167
Institutional Source Beutler Lab
Gene Symbol Faap100
Ensembl Gene ENSMUSG00000025384
Gene NameFanconi anemia core complex associated protein 100
Synonyms2310003H01Rik
MMRRC Submission 042843-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R5328 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120369055-120378764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120377632 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 105 (E105V)
Ref Sequence ENSEMBL: ENSMUSP00000026448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026448] [ENSMUST00000044271] [ENSMUST00000103017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026448
AA Change: E105V

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026448
Gene: ENSMUSG00000025384
AA Change: E105V

DomainStartEndE-ValueType
Pfam:FANCAA 447 879 1.4e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044271
SMART Domains Protein: ENSMUSP00000035851
Gene: ENSMUSG00000039703

DomainStartEndE-ValueType
Pfam:UN_NPL4 1 80 1.1e-36 PFAM
Pfam:zf-NPL4 105 245 2.1e-64 PFAM
Pfam:NPL4 248 557 4.8e-129 PFAM
ZnF_RBZ 582 606 8.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103017
SMART Domains Protein: ENSMUSP00000099306
Gene: ENSMUSG00000039703

DomainStartEndE-ValueType
Pfam:UN_NPL4 1 80 7e-38 PFAM
Pfam:zf-NPL4 104 246 1.1e-61 PFAM
Pfam:NPL4 248 455 1.8e-87 PFAM
Pfam:NPL4 451 525 3e-15 PFAM
ZnF_RBZ 550 574 8.4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154826
Meta Mutation Damage Score 0.0886 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FAAP100 is a component of the Fanconi anemia (FA; MIM 277650) core complex and is required for core complex stability and FANCD2 (see MIM 227646) monoubiquitination (Ling et al., 2007 [PubMed 17396147]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,837,694 V860E possibly damaging Het
Abcc6 T C 7: 45,992,311 D881G probably benign Het
Abcc9 A G 6: 142,682,059 V415A probably benign Het
Adgrb3 A C 1: 25,094,275 N1003K possibly damaging Het
Adora3 C T 3: 105,907,303 T123I probably benign Het
Amotl2 A C 9: 102,723,768 T345P probably benign Het
Arap3 C T 18: 37,991,687 E247K possibly damaging Het
Atp8b1 A T 18: 64,531,391 D1235E probably benign Het
Axl A T 7: 25,773,411 V400E probably damaging Het
Brd8 T A 18: 34,607,981 N431Y probably benign Het
Cadps A T 14: 12,457,790 N1025K probably benign Het
Cblc A T 7: 19,792,580 S195T possibly damaging Het
Chd2 C T 7: 73,463,681 A1184T possibly damaging Het
Chst10 G A 1: 38,895,962 probably benign Het
Col12a1 T C 9: 79,620,060 K2663E probably damaging Het
Cspg4 A T 9: 56,885,856 I292L probably benign Het
Cul1 T C 6: 47,508,317 V294A probably damaging Het
Cyp2d11 G A 15: 82,391,771 P203L probably benign Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eif3l A T 15: 79,093,361 K534* probably null Het
Enpep T C 3: 129,280,510 E796G probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fam117a T A 11: 95,364,170 probably null Het
Fan1 A T 7: 64,354,469 Y750N probably damaging Het
Fat4 T A 3: 38,956,868 I2039N probably damaging Het
Gabrr2 G T 4: 33,082,565 D106Y probably damaging Het
Gak A C 5: 108,617,001 C145G possibly damaging Het
Galnt14 A T 17: 73,505,459 N406K possibly damaging Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm10837 G T 14: 122,490,778 R22L unknown Het
Gm19965 T A 1: 116,821,418 H276Q possibly damaging Het
Gm43517 T C 12: 49,391,156 probably benign Het
Gm9733 T C 3: 15,332,174 M17V unknown Het
Greb1l A T 18: 10,553,720 I1574F probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Heatr5b G A 17: 78,826,362 T266I possibly damaging Het
Hk3 T C 13: 55,013,493 I185V probably benign Het
Hnrnpr A G 4: 136,339,216 E302G probably benign Het
Itgal T C 7: 127,311,675 probably null Het
Itk A G 11: 46,331,876 S583P probably benign Het
Loxhd1 A T 18: 77,410,572 I1448F probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Man2a2 A T 7: 80,368,756 F118L probably benign Het
Mfsd5 T A 15: 102,281,012 V273E probably damaging Het
Nfe2l2 A G 2: 75,676,856 L300P probably damaging Het
Nt5c1a T G 4: 123,208,993 L122R possibly damaging Het
Nt5c3b A G 11: 100,440,241 F42S probably damaging Het
Olfr332 C A 11: 58,490,429 A109S possibly damaging Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Pabpc1 A T 15: 36,602,877 D204E probably benign Het
Panx2 A G 15: 89,068,095 N255S probably damaging Het
Pcnt A G 10: 76,411,719 L993P probably damaging Het
Pfas A T 11: 68,988,592 C1160S probably damaging Het
Plekhh3 T A 11: 101,167,658 probably benign Het
Plod3 T A 5: 136,989,683 N258K probably damaging Het
Prr14l T C 5: 32,830,021 Q710R probably benign Het
Rnf216 G T 5: 143,092,999 T65K possibly damaging Het
Samd9l T C 6: 3,376,739 E174G probably damaging Het
Sept12 T A 16: 4,993,993 M63L possibly damaging Het
Sh3bgrl2 T A 9: 83,577,456 D22E probably benign Het
Skil A G 3: 31,117,569 K488R probably benign Het
Slamf6 T A 1: 171,938,095 I262K probably benign Het
Slc27a3 T C 3: 90,386,832 D470G probably damaging Het
Sorbs3 A T 14: 70,181,174 V680E probably damaging Het
Sox9 C T 11: 112,782,658 T25I probably benign Het
Srsf1 G T 11: 88,049,993 probably benign Het
Stard9 A C 2: 120,699,230 E1989D probably damaging Het
Thumpd2 T A 17: 81,044,162 I277F possibly damaging Het
Tinag C A 9: 77,005,631 G299* probably null Het
Tk2 A T 8: 104,229,299 probably null Het
Tmem44 A G 16: 30,540,891 S210P possibly damaging Het
Traf3ip1 C A 1: 91,520,069 P423T probably damaging Het
Trmt12 A G 15: 58,872,855 D34G probably damaging Het
Ttc39b A G 4: 83,261,941 Y72H probably damaging Het
Ttn G A 2: 76,878,411 probably benign Het
Ttyh2 T A 11: 114,710,068 I381N possibly damaging Het
Uaca A T 9: 60,870,532 N734Y probably benign Het
Usp34 T C 11: 23,464,616 I2853T probably benign Het
Usp34 G A 11: 23,488,659 G3407D probably benign Het
Vmn2r78 A G 7: 86,921,030 Y252C probably damaging Het
Wdr19 G A 5: 65,244,179 C979Y probably damaging Het
Wdr92 C A 11: 17,222,220 P103Q probably damaging Het
Yeats2 A T 16: 20,171,205 H277L probably damaging Het
Zbtb2 T C 10: 4,369,267 Y253C possibly damaging Het
Zfat C A 15: 68,179,828 G706C probably damaging Het
Zfp106 A T 2: 120,520,417 N1584K possibly damaging Het
Other mutations in Faap100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Faap100 APN 11 120372132 missense probably damaging 1.00
IGL02954:Faap100 APN 11 120372131 missense probably damaging 1.00
IGL02799:Faap100 UTSW 11 120370735 missense probably damaging 1.00
R0034:Faap100 UTSW 11 120372147 missense probably benign 0.34
R0207:Faap100 UTSW 11 120374365 missense probably damaging 1.00
R0432:Faap100 UTSW 11 120373876 splice site probably benign
R0570:Faap100 UTSW 11 120374288 missense possibly damaging 0.87
R0748:Faap100 UTSW 11 120372171 missense probably damaging 0.97
R0782:Faap100 UTSW 11 120376704 critical splice donor site probably null
R1218:Faap100 UTSW 11 120378340 missense probably benign 0.06
R1612:Faap100 UTSW 11 120377088 missense probably damaging 1.00
R1720:Faap100 UTSW 11 120374581 missense probably damaging 1.00
R1758:Faap100 UTSW 11 120377233 missense probably damaging 0.99
R2881:Faap100 UTSW 11 120374359 missense probably damaging 1.00
R2893:Faap100 UTSW 11 120374625 missense probably damaging 1.00
R3969:Faap100 UTSW 11 120378705 start codon destroyed probably null 1.00
R4824:Faap100 UTSW 11 120375586 unclassified probably null
R4911:Faap100 UTSW 11 120372113 missense probably benign 0.37
R5152:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5155:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5327:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5386:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5480:Faap100 UTSW 11 120377113 missense probably damaging 1.00
R5541:Faap100 UTSW 11 120377632 missense possibly damaging 0.71
R5629:Faap100 UTSW 11 120377011 missense probably damaging 1.00
R5911:Faap100 UTSW 11 120377132 missense possibly damaging 0.94
R6285:Faap100 UTSW 11 120376732 missense probably damaging 1.00
R6350:Faap100 UTSW 11 120374580 missense probably damaging 1.00
R6525:Faap100 UTSW 11 120378764 unclassified probably null
R7046:Faap100 UTSW 11 120377374 missense possibly damaging 0.94
R7539:Faap100 UTSW 11 120377638 missense possibly damaging 0.73
R7781:Faap100 UTSW 11 120374263 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTAGACCAAAGAGAGCCTCC -3'
(R):5'- TGGCTGATCCTGTGTCAAGC -3'

Sequencing Primer
(F):5'- GGTGCAAGTGGACAACTCC -3'
(R):5'- ATCCTGTGTCAAGCGTGTG -3'
Posted On2016-08-04