Incidental Mutation 'R5328:Yeats2'
ID 422183
Institutional Source Beutler Lab
Gene Symbol Yeats2
Ensembl Gene ENSMUSG00000041215
Gene Name YEATS domain containing 2
Synonyms
MMRRC Submission 042843-MU
Accession Numbers

Ncbi RefSeq: NM_001145930.1, NM_001033237.2, NM_001145931.1; MGI:2447762

Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R5328 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 20141063-20232573 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20171205 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 277 (H277L)
Ref Sequence ENSEMBL: ENSMUSP00000111222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090052] [ENSMUST00000115560] [ENSMUST00000232019] [ENSMUST00000232338]
AlphaFold Q3TUF7
Predicted Effect probably damaging
Transcript: ENSMUST00000090052
AA Change: H224L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087506
Gene: ENSMUSG00000041215
AA Change: H224L

DomainStartEndE-ValueType
Pfam:YEATS 179 262 2.6e-27 PFAM
low complexity region 299 309 N/A INTRINSIC
low complexity region 312 333 N/A INTRINSIC
low complexity region 409 429 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
internal_repeat_1 471 675 3.72e-6 PROSPERO
low complexity region 683 702 N/A INTRINSIC
low complexity region 738 775 N/A INTRINSIC
internal_repeat_1 785 978 3.72e-6 PROSPERO
low complexity region 1240 1249 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115560
AA Change: H277L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111222
Gene: ENSMUSG00000041215
AA Change: H277L

DomainStartEndE-ValueType
Pfam:YEATS 232 314 2.1e-28 PFAM
low complexity region 352 362 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
low complexity region 511 520 N/A INTRINSIC
internal_repeat_1 524 728 4.68e-6 PROSPERO
low complexity region 736 755 N/A INTRINSIC
low complexity region 791 828 N/A INTRINSIC
internal_repeat_1 838 1031 4.68e-6 PROSPERO
low complexity region 1293 1302 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000232019
AA Change: H240L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232172
Predicted Effect probably damaging
Transcript: ENSMUST00000232338
AA Change: H221L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] YEATS2 is a scaffolding subunit of the ADA2A (TADA2A; MIM 602276)-containing (ATAC) histone acetyltransferase complex (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]
Allele List at MGI

All alleles(34) : Targeted(1) Gene trapped(33)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,837,694 V860E possibly damaging Het
Abcc6 T C 7: 45,992,311 D881G probably benign Het
Abcc9 A G 6: 142,682,059 V415A probably benign Het
Adgrb3 A C 1: 25,094,275 N1003K possibly damaging Het
Adora3 C T 3: 105,907,303 T123I probably benign Het
Amotl2 A C 9: 102,723,768 T345P probably benign Het
Arap3 C T 18: 37,991,687 E247K possibly damaging Het
Atp8b1 A T 18: 64,531,391 D1235E probably benign Het
Axl A T 7: 25,773,411 V400E probably damaging Het
Brd8 T A 18: 34,607,981 N431Y probably benign Het
Cadps A T 14: 12,457,790 N1025K probably benign Het
Cblc A T 7: 19,792,580 S195T possibly damaging Het
Chd2 C T 7: 73,463,681 A1184T possibly damaging Het
Chst10 G A 1: 38,895,962 probably benign Het
Col12a1 T C 9: 79,620,060 K2663E probably damaging Het
Cspg4 A T 9: 56,885,856 I292L probably benign Het
Cul1 T C 6: 47,508,317 V294A probably damaging Het
Cyp2d11 G A 15: 82,391,771 P203L probably benign Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eif3l A T 15: 79,093,361 K534* probably null Het
Enpep T C 3: 129,280,510 E796G probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam117a T A 11: 95,364,170 probably null Het
Fan1 A T 7: 64,354,469 Y750N probably damaging Het
Fat4 T A 3: 38,956,868 I2039N probably damaging Het
Gabrr2 G T 4: 33,082,565 D106Y probably damaging Het
Gak A C 5: 108,617,001 C145G possibly damaging Het
Galnt14 A T 17: 73,505,459 N406K possibly damaging Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm10837 G T 14: 122,490,778 R22L unknown Het
Gm19965 T A 1: 116,821,418 H276Q possibly damaging Het
Gm43517 T C 12: 49,391,156 probably benign Het
Gm9733 T C 3: 15,332,174 M17V unknown Het
Greb1l A T 18: 10,553,720 I1574F probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Heatr5b G A 17: 78,826,362 T266I possibly damaging Het
Hk3 T C 13: 55,013,493 I185V probably benign Het
Hnrnpr A G 4: 136,339,216 E302G probably benign Het
Itgal T C 7: 127,311,675 probably null Het
Itk A G 11: 46,331,876 S583P probably benign Het
Loxhd1 A T 18: 77,410,572 I1448F probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Man2a2 A T 7: 80,368,756 F118L probably benign Het
Mfsd5 T A 15: 102,281,012 V273E probably damaging Het
Nfe2l2 A G 2: 75,676,856 L300P probably damaging Het
Nt5c1a T G 4: 123,208,993 L122R possibly damaging Het
Nt5c3b A G 11: 100,440,241 F42S probably damaging Het
Olfr332 C A 11: 58,490,429 A109S possibly damaging Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Pabpc1 A T 15: 36,602,877 D204E probably benign Het
Panx2 A G 15: 89,068,095 N255S probably damaging Het
Pcnt A G 10: 76,411,719 L993P probably damaging Het
Pfas A T 11: 68,988,592 C1160S probably damaging Het
Plekhh3 T A 11: 101,167,658 probably benign Het
Plod3 T A 5: 136,989,683 N258K probably damaging Het
Prr14l T C 5: 32,830,021 Q710R probably benign Het
Rnf216 G T 5: 143,092,999 T65K possibly damaging Het
Samd9l T C 6: 3,376,739 E174G probably damaging Het
Sept12 T A 16: 4,993,993 M63L possibly damaging Het
Sh3bgrl2 T A 9: 83,577,456 D22E probably benign Het
Skil A G 3: 31,117,569 K488R probably benign Het
Slamf6 T A 1: 171,938,095 I262K probably benign Het
Slc27a3 T C 3: 90,386,832 D470G probably damaging Het
Sorbs3 A T 14: 70,181,174 V680E probably damaging Het
Sox9 C T 11: 112,782,658 T25I probably benign Het
Srsf1 G T 11: 88,049,993 probably benign Het
Stard9 A C 2: 120,699,230 E1989D probably damaging Het
Thumpd2 T A 17: 81,044,162 I277F possibly damaging Het
Tinag C A 9: 77,005,631 G299* probably null Het
Tk2 A T 8: 104,229,299 probably null Het
Tmem44 A G 16: 30,540,891 S210P possibly damaging Het
Traf3ip1 C A 1: 91,520,069 P423T probably damaging Het
Trmt12 A G 15: 58,872,855 D34G probably damaging Het
Ttc39b A G 4: 83,261,941 Y72H probably damaging Het
Ttn G A 2: 76,878,411 probably benign Het
Ttyh2 T A 11: 114,710,068 I381N possibly damaging Het
Uaca A T 9: 60,870,532 N734Y probably benign Het
Usp34 T C 11: 23,464,616 I2853T probably benign Het
Usp34 G A 11: 23,488,659 G3407D probably benign Het
Vmn2r78 A G 7: 86,921,030 Y252C probably damaging Het
Wdr19 G A 5: 65,244,179 C979Y probably damaging Het
Wdr92 C A 11: 17,222,220 P103Q probably damaging Het
Zbtb2 T C 10: 4,369,267 Y253C possibly damaging Het
Zfat C A 15: 68,179,828 G706C probably damaging Het
Zfp106 A T 2: 120,520,417 N1584K possibly damaging Het
Other mutations in Yeats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Yeats2 APN 16 20186304 missense probably damaging 0.99
IGL01128:Yeats2 APN 16 20161968 splice site probably benign
IGL01139:Yeats2 APN 16 20214393 missense probably damaging 1.00
IGL01394:Yeats2 APN 16 20162032 missense probably damaging 0.99
IGL01482:Yeats2 APN 16 20222921 missense probably damaging 1.00
IGL01924:Yeats2 APN 16 20206167 missense probably damaging 1.00
IGL01925:Yeats2 APN 16 20179680 splice site probably benign
IGL02106:Yeats2 APN 16 20193220 missense possibly damaging 0.79
IGL02370:Yeats2 APN 16 20150471 missense probably damaging 0.99
IGL02447:Yeats2 APN 16 20193679 missense probably benign 0.00
IGL02669:Yeats2 APN 16 20186283 missense probably benign 0.13
IGL03155:Yeats2 APN 16 20229573 critical splice donor site probably null
tyrion UTSW 16 20213401 splice site probably benign
P0045:Yeats2 UTSW 16 20156945 missense possibly damaging 0.47
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0051:Yeats2 UTSW 16 20193724 nonsense probably null
R0118:Yeats2 UTSW 16 20156942 nonsense probably null
R0157:Yeats2 UTSW 16 20221677 makesense probably null
R0184:Yeats2 UTSW 16 20203685 missense possibly damaging 0.79
R0194:Yeats2 UTSW 16 20152969 start codon destroyed probably null 1.00
R0612:Yeats2 UTSW 16 20186425 missense probably benign 0.00
R0655:Yeats2 UTSW 16 20193824 nonsense probably null
R0826:Yeats2 UTSW 16 20193216 nonsense probably null
R1526:Yeats2 UTSW 16 20206086 missense probably damaging 1.00
R1535:Yeats2 UTSW 16 20189365 missense probably damaging 0.99
R1749:Yeats2 UTSW 16 20186268 nonsense probably null
R1842:Yeats2 UTSW 16 20171238 missense probably damaging 1.00
R1843:Yeats2 UTSW 16 20229564 missense probably benign 0.01
R1926:Yeats2 UTSW 16 20214426 missense probably benign
R2000:Yeats2 UTSW 16 20186391 missense probably benign 0.20
R2017:Yeats2 UTSW 16 20159181 missense probably benign 0.01
R2076:Yeats2 UTSW 16 20186282 missense possibly damaging 0.47
R2153:Yeats2 UTSW 16 20154166 missense probably damaging 1.00
R2167:Yeats2 UTSW 16 20213401 splice site probably benign
R2981:Yeats2 UTSW 16 20186301 missense probably damaging 0.99
R3160:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3161:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3162:Yeats2 UTSW 16 20193645 missense probably damaging 1.00
R3774:Yeats2 UTSW 16 20150495 missense probably damaging 1.00
R4250:Yeats2 UTSW 16 20156935 missense possibly damaging 0.90
R4305:Yeats2 UTSW 16 20208422 missense probably damaging 1.00
R4455:Yeats2 UTSW 16 20161993 missense possibly damaging 0.88
R4458:Yeats2 UTSW 16 20213321 missense probably damaging 0.99
R4811:Yeats2 UTSW 16 20152895 splice site probably null
R4902:Yeats2 UTSW 16 20207668 missense probably benign 0.00
R5043:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5047:Yeats2 UTSW 16 20208465 missense probably damaging 1.00
R5319:Yeats2 UTSW 16 20186425 missense probably benign 0.01
R5360:Yeats2 UTSW 16 20154162 missense probably damaging 0.97
R5416:Yeats2 UTSW 16 20211569 missense probably benign 0.01
R5672:Yeats2 UTSW 16 20162029 missense probably damaging 1.00
R5684:Yeats2 UTSW 16 20193803 missense possibly damaging 0.94
R5932:Yeats2 UTSW 16 20193163 missense probably benign 0.06
R5946:Yeats2 UTSW 16 20207763 nonsense probably null
R6168:Yeats2 UTSW 16 20179558 missense probably benign 0.01
R6169:Yeats2 UTSW 16 20219667 missense probably damaging 1.00
R6179:Yeats2 UTSW 16 20214475 missense probably benign 0.16
R6371:Yeats2 UTSW 16 20221710 missense possibly damaging 0.54
R6877:Yeats2 UTSW 16 20179594 missense probably benign 0.00
R7149:Yeats2 UTSW 16 20154189 missense probably damaging 1.00
R7405:Yeats2 UTSW 16 20222913 missense probably damaging 1.00
R8353:Yeats2 UTSW 16 20222887 nonsense probably null
R8367:Yeats2 UTSW 16 20222825 missense probably damaging 1.00
R8453:Yeats2 UTSW 16 20222887 nonsense probably null
R8506:Yeats2 UTSW 16 20152934 missense probably damaging 0.98
R8535:Yeats2 UTSW 16 20159176 missense probably damaging 1.00
R8828:Yeats2 UTSW 16 20150510 missense probably benign 0.45
R8905:Yeats2 UTSW 16 20190394 missense probably benign 0.02
R8924:Yeats2 UTSW 16 20150562 critical splice donor site probably null
R9087:Yeats2 UTSW 16 20211750 critical splice donor site probably null
R9276:Yeats2 UTSW 16 20157036 missense probably benign 0.34
R9338:Yeats2 UTSW 16 20213328 missense possibly damaging 0.69
R9338:Yeats2 UTSW 16 20222783 missense probably damaging 0.99
R9378:Yeats2 UTSW 16 20214478 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATTATACAGTTTGCACCTCTTATCC -3'
(R):5'- TGCACCATCGAAGCCATGAC -3'

Sequencing Primer
(F):5'- ACAGTTTGCACCTCTTATCCATAAC -3'
(R):5'- ATCGAAGCCATGACCGTCG -3'
Posted On 2016-08-04