Incidental Mutation 'R5328:Dscam'
ID 422185
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene Name DS cell adhesion molecule
Synonyms 4932410A21Rik, Down syndrome cell adhesion molecule
MMRRC Submission 042843-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5328 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 96392040-96971952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96474878 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1228 (H1228R)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
AlphaFold Q9ERC8
Predicted Effect probably benign
Transcript: ENSMUST00000056102
AA Change: H1228R

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: H1228R

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Meta Mutation Damage Score 0.0883 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,887,694 (GRCm39) V860E possibly damaging Het
Abcc6 T C 7: 45,641,735 (GRCm39) D881G probably benign Het
Abcc9 A G 6: 142,627,785 (GRCm39) V415A probably benign Het
Adgrb3 A C 1: 25,133,356 (GRCm39) N1003K possibly damaging Het
Adora3 C T 3: 105,814,619 (GRCm39) T123I probably benign Het
Amotl2 A C 9: 102,600,967 (GRCm39) T345P probably benign Het
Arap3 C T 18: 38,124,740 (GRCm39) E247K possibly damaging Het
Atp8b1 A T 18: 64,664,462 (GRCm39) D1235E probably benign Het
Axl A T 7: 25,472,836 (GRCm39) V400E probably damaging Het
Brd8 T A 18: 34,741,034 (GRCm39) N431Y probably benign Het
Cadps A T 14: 12,457,790 (GRCm38) N1025K probably benign Het
Cblc A T 7: 19,526,505 (GRCm39) S195T possibly damaging Het
Chd2 C T 7: 73,113,429 (GRCm39) A1184T possibly damaging Het
Chst10 G A 1: 38,935,043 (GRCm39) probably benign Het
Col12a1 T C 9: 79,527,342 (GRCm39) K2663E probably damaging Het
Cspg4 A T 9: 56,793,140 (GRCm39) I292L probably benign Het
Cul1 T C 6: 47,485,251 (GRCm39) V294A probably damaging Het
Cyp2d11 G A 15: 82,275,972 (GRCm39) P203L probably benign Het
Dnaaf10 C A 11: 17,172,220 (GRCm39) P103Q probably damaging Het
Eif3l A T 15: 78,977,561 (GRCm39) K534* probably null Het
Enpep T C 3: 129,074,159 (GRCm39) E796G probably benign Het
Ext1 C A 15: 52,939,213 (GRCm39) W612L probably damaging Het
Faap100 T A 11: 120,268,458 (GRCm39) E105V possibly damaging Het
Fam117a T A 11: 95,254,996 (GRCm39) probably null Het
Fan1 A T 7: 64,004,217 (GRCm39) Y750N probably damaging Het
Fat4 T A 3: 39,011,017 (GRCm39) I2039N probably damaging Het
Gabrr2 G T 4: 33,082,565 (GRCm39) D106Y probably damaging Het
Gak A C 5: 108,764,867 (GRCm39) C145G possibly damaging Het
Galnt14 A T 17: 73,812,454 (GRCm39) N406K possibly damaging Het
Gm10439 T G X: 148,419,159 (GRCm39) *434E probably null Het
Gm10837 G T 14: 122,728,190 (GRCm39) R22L unknown Het
Gm19965 T A 1: 116,749,148 (GRCm39) H276Q possibly damaging Het
Gm43517 T C 12: 49,437,939 (GRCm39) probably benign Het
Greb1l A T 18: 10,553,720 (GRCm39) I1574F probably damaging Het
Gzme G A 14: 56,355,224 (GRCm39) H236Y probably benign Het
Heatr5b G A 17: 79,133,791 (GRCm39) T266I possibly damaging Het
Hk3 T C 13: 55,161,306 (GRCm39) I185V probably benign Het
Hnrnpr A G 4: 136,066,527 (GRCm39) E302G probably benign Het
Itgal T C 7: 126,910,847 (GRCm39) probably null Het
Itk A G 11: 46,222,703 (GRCm39) S583P probably benign Het
Loxhd1 A T 18: 77,498,268 (GRCm39) I1448F probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,244,784 (GRCm39) probably null Het
Man2a2 A T 7: 80,018,504 (GRCm39) F118L probably benign Het
Mfsd5 T A 15: 102,189,447 (GRCm39) V273E probably damaging Het
Nfe2l2 A G 2: 75,507,200 (GRCm39) L300P probably damaging Het
Nt5c1a T G 4: 123,102,786 (GRCm39) L122R possibly damaging Het
Nt5c3b A G 11: 100,331,067 (GRCm39) F42S probably damaging Het
Or2av9 C A 11: 58,381,255 (GRCm39) A109S possibly damaging Het
Or51g2 T A 7: 102,623,175 (GRCm39) N8I possibly damaging Het
Pabpc1 A T 15: 36,603,121 (GRCm39) D204E probably benign Het
Panx2 A G 15: 88,952,298 (GRCm39) N255S probably damaging Het
Pcnt A G 10: 76,247,553 (GRCm39) L993P probably damaging Het
Pfas A T 11: 68,879,418 (GRCm39) C1160S probably damaging Het
Plekhh3 T A 11: 101,058,484 (GRCm39) probably benign Het
Plod3 T A 5: 137,018,537 (GRCm39) N258K probably damaging Het
Prr14l T C 5: 32,987,365 (GRCm39) Q710R probably benign Het
Rnf216 G T 5: 143,078,754 (GRCm39) T65K possibly damaging Het
Samd9l T C 6: 3,376,739 (GRCm39) E174G probably damaging Het
Septin12 T A 16: 4,811,857 (GRCm39) M63L possibly damaging Het
Sh3bgrl2 T A 9: 83,459,509 (GRCm39) D22E probably benign Het
Sirpd T C 3: 15,397,234 (GRCm39) M17V unknown Het
Skil A G 3: 31,171,718 (GRCm39) K488R probably benign Het
Slamf6 T A 1: 171,765,662 (GRCm39) I262K probably benign Het
Slc27a3 T C 3: 90,294,139 (GRCm39) D470G probably damaging Het
Sorbs3 A T 14: 70,418,623 (GRCm39) V680E probably damaging Het
Sox9 C T 11: 112,673,484 (GRCm39) T25I probably benign Het
Srsf1 G T 11: 87,940,819 (GRCm39) probably benign Het
Stard9 A C 2: 120,529,711 (GRCm39) E1989D probably damaging Het
Thumpd2 T A 17: 81,351,591 (GRCm39) I277F possibly damaging Het
Tinag C A 9: 76,912,913 (GRCm39) G299* probably null Het
Tk2 A T 8: 104,955,931 (GRCm39) probably null Het
Tmem44 A G 16: 30,359,709 (GRCm39) S210P possibly damaging Het
Traf3ip1 C A 1: 91,447,791 (GRCm39) P423T probably damaging Het
Trmt12 A G 15: 58,744,704 (GRCm39) D34G probably damaging Het
Ttc39b A G 4: 83,180,178 (GRCm39) Y72H probably damaging Het
Ttn G A 2: 76,708,755 (GRCm39) probably benign Het
Ttyh2 T A 11: 114,600,894 (GRCm39) I381N possibly damaging Het
Uaca A T 9: 60,777,814 (GRCm39) N734Y probably benign Het
Usp34 T C 11: 23,414,616 (GRCm39) I2853T probably benign Het
Usp34 G A 11: 23,438,659 (GRCm39) G3407D probably benign Het
Vmn2r78 A G 7: 86,570,238 (GRCm39) Y252C probably damaging Het
Wdr19 G A 5: 65,401,522 (GRCm39) C979Y probably damaging Het
Yeats2 A T 16: 19,989,955 (GRCm39) H277L probably damaging Het
Zbtb2 T C 10: 4,319,267 (GRCm39) Y253C possibly damaging Het
Zfat C A 15: 68,051,677 (GRCm39) G706C probably damaging Het
Zfp106 A T 2: 120,350,898 (GRCm39) N1584K possibly damaging Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96,409,265 (GRCm39) missense possibly damaging 0.64
IGL00841:Dscam APN 16 96,621,077 (GRCm39) missense probably damaging 1.00
IGL01289:Dscam APN 16 96,445,082 (GRCm39) nonsense probably null
IGL01358:Dscam APN 16 96,411,543 (GRCm39) missense possibly damaging 0.68
IGL01431:Dscam APN 16 96,453,278 (GRCm39) critical splice donor site probably null
IGL01444:Dscam APN 16 96,474,909 (GRCm39) missense possibly damaging 0.95
IGL01767:Dscam APN 16 96,456,136 (GRCm39) missense probably damaging 1.00
IGL01866:Dscam APN 16 96,486,550 (GRCm39) missense probably benign 0.06
IGL02020:Dscam APN 16 96,517,269 (GRCm39) missense probably damaging 1.00
IGL02023:Dscam APN 16 96,602,397 (GRCm39) missense probably benign 0.06
IGL02057:Dscam APN 16 96,517,273 (GRCm39) nonsense probably null
IGL02389:Dscam APN 16 96,442,097 (GRCm39) missense probably benign 0.27
IGL02409:Dscam APN 16 96,621,088 (GRCm39) missense possibly damaging 0.46
IGL02694:Dscam APN 16 96,394,476 (GRCm39) missense probably benign 0.00
IGL02899:Dscam APN 16 96,510,447 (GRCm39) missense probably damaging 0.98
IGL02956:Dscam APN 16 96,602,472 (GRCm39) missense probably damaging 0.98
IGL03035:Dscam APN 16 96,621,170 (GRCm39) missense possibly damaging 0.94
IGL03191:Dscam APN 16 96,621,969 (GRCm39) missense probably benign 0.36
growler UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
Twostep UTSW 16 96,626,982 (GRCm39) splice site probably null
F6893:Dscam UTSW 16 96,857,660 (GRCm39) missense possibly damaging 0.78
K3955:Dscam UTSW 16 96,474,887 (GRCm39) missense probably benign 0.00
R0024:Dscam UTSW 16 96,394,585 (GRCm39) nonsense probably null
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0057:Dscam UTSW 16 96,474,936 (GRCm39) missense probably damaging 1.00
R0117:Dscam UTSW 16 96,474,878 (GRCm39) missense probably benign 0.33
R0211:Dscam UTSW 16 96,517,279 (GRCm39) missense possibly damaging 0.50
R0280:Dscam UTSW 16 96,840,206 (GRCm39) missense possibly damaging 0.62
R0355:Dscam UTSW 16 96,456,105 (GRCm39) missense probably benign 0.00
R0380:Dscam UTSW 16 96,857,810 (GRCm39) missense probably damaging 1.00
R0445:Dscam UTSW 16 96,573,703 (GRCm39) missense probably damaging 1.00
R0492:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0534:Dscam UTSW 16 96,453,372 (GRCm39) missense possibly damaging 0.67
R0593:Dscam UTSW 16 96,573,608 (GRCm39) missense probably benign 0.19
R0707:Dscam UTSW 16 96,626,982 (GRCm39) splice site probably null
R0738:Dscam UTSW 16 96,620,981 (GRCm39) missense possibly damaging 0.48
R1017:Dscam UTSW 16 96,634,633 (GRCm39) missense probably damaging 1.00
R1377:Dscam UTSW 16 96,573,694 (GRCm39) missense probably damaging 1.00
R1440:Dscam UTSW 16 96,621,151 (GRCm39) missense probably damaging 1.00
R1442:Dscam UTSW 16 96,409,274 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1464:Dscam UTSW 16 96,602,453 (GRCm39) missense possibly damaging 0.94
R1478:Dscam UTSW 16 96,592,110 (GRCm39) missense probably benign 0.15
R1530:Dscam UTSW 16 96,621,074 (GRCm39) missense probably damaging 1.00
R1731:Dscam UTSW 16 96,621,076 (GRCm39) missense probably damaging 1.00
R1765:Dscam UTSW 16 96,486,579 (GRCm39) missense probably benign 0.00
R1824:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign 0.00
R1933:Dscam UTSW 16 96,394,414 (GRCm39) missense probably benign 0.00
R2005:Dscam UTSW 16 96,840,120 (GRCm39) missense probably benign 0.02
R2006:Dscam UTSW 16 96,621,112 (GRCm39) missense probably damaging 1.00
R2101:Dscam UTSW 16 96,411,549 (GRCm39) missense probably benign 0.00
R2177:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 0.98
R2342:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R2851:Dscam UTSW 16 96,423,915 (GRCm39) missense possibly damaging 0.94
R2929:Dscam UTSW 16 96,486,612 (GRCm39) missense possibly damaging 0.76
R3055:Dscam UTSW 16 96,602,555 (GRCm39) missense probably damaging 1.00
R3157:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3159:Dscam UTSW 16 96,479,710 (GRCm39) missense probably benign 0.16
R3944:Dscam UTSW 16 96,622,197 (GRCm39) missense probably damaging 0.99
R4080:Dscam UTSW 16 96,484,972 (GRCm39) missense probably benign 0.01
R4285:Dscam UTSW 16 96,510,309 (GRCm39) critical splice donor site probably null
R4384:Dscam UTSW 16 96,510,416 (GRCm39) missense probably damaging 0.99
R4460:Dscam UTSW 16 96,411,519 (GRCm39) missense probably damaging 1.00
R4575:Dscam UTSW 16 96,626,823 (GRCm39) missense possibly damaging 0.82
R4594:Dscam UTSW 16 96,519,196 (GRCm39) missense possibly damaging 0.78
R4643:Dscam UTSW 16 96,486,501 (GRCm39) missense probably damaging 0.96
R4698:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R4716:Dscam UTSW 16 96,420,771 (GRCm39) missense possibly damaging 0.80
R4743:Dscam UTSW 16 96,631,256 (GRCm39) missense probably benign 0.00
R4766:Dscam UTSW 16 96,445,188 (GRCm39) missense probably benign 0.02
R4899:Dscam UTSW 16 96,485,018 (GRCm39) missense probably benign 0.01
R4987:Dscam UTSW 16 96,498,721 (GRCm39) missense probably benign 0.00
R4990:Dscam UTSW 16 96,626,715 (GRCm39) missense probably benign 0.12
R5123:Dscam UTSW 16 96,573,637 (GRCm39) missense probably damaging 1.00
R5130:Dscam UTSW 16 96,620,979 (GRCm39) missense probably benign 0.00
R5666:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5670:Dscam UTSW 16 96,519,364 (GRCm39) missense probably benign 0.23
R5678:Dscam UTSW 16 96,592,100 (GRCm39) missense probably benign 0.16
R5827:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R5907:Dscam UTSW 16 96,622,120 (GRCm39) missense probably damaging 0.97
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6032:Dscam UTSW 16 96,451,191 (GRCm39) critical splice donor site probably null
R6103:Dscam UTSW 16 96,626,781 (GRCm39) missense probably benign
R6240:Dscam UTSW 16 96,420,702 (GRCm39) missense probably damaging 1.00
R6257:Dscam UTSW 16 96,474,914 (GRCm39) missense possibly damaging 0.94
R6361:Dscam UTSW 16 96,424,011 (GRCm39) missense probably benign 0.08
R6405:Dscam UTSW 16 96,479,625 (GRCm39) missense probably damaging 1.00
R6444:Dscam UTSW 16 96,420,844 (GRCm39) missense probably damaging 1.00
R6560:Dscam UTSW 16 96,626,935 (GRCm39) missense probably benign 0.00
R6598:Dscam UTSW 16 96,620,984 (GRCm39) missense probably damaging 1.00
R6622:Dscam UTSW 16 96,446,273 (GRCm39) missense probably benign 0.06
R6792:Dscam UTSW 16 96,449,437 (GRCm39) missense probably damaging 1.00
R6792:Dscam UTSW 16 96,394,455 (GRCm39) missense probably damaging 0.96
R6827:Dscam UTSW 16 96,840,191 (GRCm39) missense probably damaging 1.00
R6868:Dscam UTSW 16 96,631,140 (GRCm39) missense probably damaging 1.00
R6898:Dscam UTSW 16 96,631,100 (GRCm39) missense probably benign 0.02
R6903:Dscam UTSW 16 96,621,988 (GRCm39) missense probably damaging 1.00
R7051:Dscam UTSW 16 96,620,986 (GRCm39) missense probably benign 0.01
R7146:Dscam UTSW 16 96,631,117 (GRCm39) nonsense probably null
R7180:Dscam UTSW 16 96,626,764 (GRCm39) missense probably damaging 0.97
R7209:Dscam UTSW 16 96,451,544 (GRCm39) splice site probably null
R7247:Dscam UTSW 16 96,622,008 (GRCm39) missense probably damaging 0.99
R7269:Dscam UTSW 16 96,479,601 (GRCm39) missense probably benign 0.00
R7301:Dscam UTSW 16 96,857,732 (GRCm39) missense probably benign 0.01
R7328:Dscam UTSW 16 96,446,235 (GRCm39) nonsense probably null
R7368:Dscam UTSW 16 96,445,131 (GRCm39) missense probably benign 0.00
R7425:Dscam UTSW 16 96,430,598 (GRCm39) missense probably damaging 1.00
R7474:Dscam UTSW 16 96,621,089 (GRCm39) missense possibly damaging 0.88
R7536:Dscam UTSW 16 96,442,226 (GRCm39) splice site probably null
R7624:Dscam UTSW 16 96,411,524 (GRCm39) missense probably damaging 1.00
R7766:Dscam UTSW 16 96,592,101 (GRCm39) missense probably benign 0.31
R7817:Dscam UTSW 16 96,442,064 (GRCm39) missense probably benign
R7843:Dscam UTSW 16 96,626,830 (GRCm39) missense probably damaging 0.99
R7911:Dscam UTSW 16 96,445,122 (GRCm39) missense probably benign 0.01
R8108:Dscam UTSW 16 96,445,079 (GRCm39) missense probably benign 0.01
R8128:Dscam UTSW 16 96,602,374 (GRCm39) splice site probably null
R8770:Dscam UTSW 16 96,456,106 (GRCm39) missense possibly damaging 0.50
R8876:Dscam UTSW 16 96,420,828 (GRCm39) missense probably damaging 0.96
R9005:Dscam UTSW 16 96,602,580 (GRCm39) missense probably damaging 1.00
R9009:Dscam UTSW 16 96,840,116 (GRCm39) missense probably benign 0.10
R9168:Dscam UTSW 16 96,420,768 (GRCm39) missense possibly damaging 0.82
R9176:Dscam UTSW 16 96,486,553 (GRCm39) missense probably benign 0.37
R9244:Dscam UTSW 16 96,486,429 (GRCm39) missense possibly damaging 0.62
R9339:Dscam UTSW 16 96,517,263 (GRCm39) missense possibly damaging 0.89
R9374:Dscam UTSW 16 96,857,857 (GRCm39) missense probably benign 0.19
R9385:Dscam UTSW 16 96,840,203 (GRCm39) missense probably benign
R9674:Dscam UTSW 16 96,442,036 (GRCm39) missense probably benign 0.03
X0025:Dscam UTSW 16 96,510,361 (GRCm39) missense probably damaging 1.00
Z1088:Dscam UTSW 16 96,573,761 (GRCm39) missense probably benign 0.01
Z1177:Dscam UTSW 16 96,409,389 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGATAAACAAGGGCTCTAGGC -3'
(R):5'- GAGCCATGGGAAGCTACATTC -3'

Sequencing Primer
(F):5'- CCGCGTAATAAAGCAGGAGTCTTC -3'
(R):5'- GGAAGCTACATTCCACCCTGTG -3'
Posted On 2016-08-04