Mutagenetix > Incidental Mutation

Incidental Mutation 'R5328:Atp8b1'

422192

Institutional Source

Beutler Lab

Gene Symbol

Atp8b1

Ensembl Gene

ENSMUSG00000039529

Gene Name

ATPase, class I, type 8B, member 1

Synonyms

FIC1, Ic

MMRRC Submission

042843-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5328 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64528979-64661000 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64531391 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1235 (D1235E)

Ref Sequence

ENSEMBL: ENSMUSP00000025482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025482]

AlphaFold

Q148W0

Predicted Effect

probably benign
Transcript: ENSMUST00000025482
AA Change: D1235E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: D1235E

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	65	144	5.3e-29	PFAM
Pfam:E1-E2_ATPase	146	413	6e-11	PFAM
Pfam:HAD	451	902	2.4e-21	PFAM
Pfam:Cation_ATPase	532	632	1e-12	PFAM
Pfam:PhoLip_ATPase_C	919	1173	7.3e-82	PFAM
low complexity region	1193	1207	N/A	INTRINSIC
low complexity region	1221	1232	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,837,694	V860E	possibly damaging	Het
Abcc6	T	C	7: 45,992,311	D881G	probably benign	Het
Abcc9	A	G	6: 142,682,059	V415A	probably benign	Het
Adgrb3	A	C	1: 25,094,275	N1003K	possibly damaging	Het
Adora3	C	T	3: 105,907,303	T123I	probably benign	Het
Amotl2	A	C	9: 102,723,768	T345P	probably benign	Het
Arap3	C	T	18: 37,991,687	E247K	possibly damaging	Het
Axl	A	T	7: 25,773,411	V400E	probably damaging	Het
Brd8	T	A	18: 34,607,981	N431Y	probably benign	Het
Cadps	A	T	14: 12,457,790	N1025K	probably benign	Het
Cblc	A	T	7: 19,792,580	S195T	possibly damaging	Het
Chd2	C	T	7: 73,463,681	A1184T	possibly damaging	Het
Chst10	G	A	1: 38,895,962		probably benign	Het
Col12a1	T	C	9: 79,620,060	K2663E	probably damaging	Het
Cspg4	A	T	9: 56,885,856	I292L	probably benign	Het
Cul1	T	C	6: 47,508,317	V294A	probably damaging	Het
Cyp2d11	G	A	15: 82,391,771	P203L	probably benign	Het
Dscam	T	C	16: 96,673,678	H1228R	probably benign	Het
Eif3l	A	T	15: 79,093,361	K534*	probably null	Het
Enpep	T	C	3: 129,280,510	E796G	probably benign	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fam117a	T	A	11: 95,364,170		probably null	Het
Fan1	A	T	7: 64,354,469	Y750N	probably damaging	Het
Fat4	T	A	3: 38,956,868	I2039N	probably damaging	Het
Gabrr2	G	T	4: 33,082,565	D106Y	probably damaging	Het
Gak	A	C	5: 108,617,001	C145G	possibly damaging	Het
Galnt14	A	T	17: 73,505,459	N406K	possibly damaging	Het
Gm10439	T	G	X: 149,636,163	*434E	probably null	Het
Gm10837	G	T	14: 122,490,778	R22L	unknown	Het
Gm19965	T	A	1: 116,821,418	H276Q	possibly damaging	Het
Gm43517	T	C	12: 49,391,156		probably benign	Het
Gm9733	T	C	3: 15,332,174	M17V	unknown	Het
Greb1l	A	T	18: 10,553,720	I1574F	probably damaging	Het
Gzme	G	A	14: 56,117,767	H236Y	probably benign	Het
Heatr5b	G	A	17: 78,826,362	T266I	possibly damaging	Het
Hk3	T	C	13: 55,013,493	I185V	probably benign	Het
Hnrnpr	A	G	4: 136,339,216	E302G	probably benign	Het
Itgal	T	C	7: 127,311,675		probably null	Het
Itk	A	G	11: 46,331,876	S583P	probably benign	Het
Loxhd1	A	T	18: 77,410,572	I1448F	probably damaging	Het
Macf1	GCCCCC	GCCCCCC	4: 123,350,991		probably null	Het
Man2a2	A	T	7: 80,368,756	F118L	probably benign	Het
Mfsd5	T	A	15: 102,281,012	V273E	probably damaging	Het
Nfe2l2	A	G	2: 75,676,856	L300P	probably damaging	Het
Nt5c1a	T	G	4: 123,208,993	L122R	possibly damaging	Het
Nt5c3b	A	G	11: 100,440,241	F42S	probably damaging	Het
Olfr332	C	A	11: 58,490,429	A109S	possibly damaging	Het
Olfr577	T	A	7: 102,973,968	N8I	possibly damaging	Het
Pabpc1	A	T	15: 36,602,877	D204E	probably benign	Het
Panx2	A	G	15: 89,068,095	N255S	probably damaging	Het
Pcnt	A	G	10: 76,411,719	L993P	probably damaging	Het
Pfas	A	T	11: 68,988,592	C1160S	probably damaging	Het
Plekhh3	T	A	11: 101,167,658		probably benign	Het
Plod3	T	A	5: 136,989,683	N258K	probably damaging	Het
Prr14l	T	C	5: 32,830,021	Q710R	probably benign	Het
Rnf216	G	T	5: 143,092,999	T65K	possibly damaging	Het
Samd9l	T	C	6: 3,376,739	E174G	probably damaging	Het
Sept12	T	A	16: 4,993,993	M63L	possibly damaging	Het
Sh3bgrl2	T	A	9: 83,577,456	D22E	probably benign	Het
Skil	A	G	3: 31,117,569	K488R	probably benign	Het
Slamf6	T	A	1: 171,938,095	I262K	probably benign	Het
Slc27a3	T	C	3: 90,386,832	D470G	probably damaging	Het
Sorbs3	A	T	14: 70,181,174	V680E	probably damaging	Het
Sox9	C	T	11: 112,782,658	T25I	probably benign	Het
Srsf1	G	T	11: 88,049,993		probably benign	Het
Stard9	A	C	2: 120,699,230	E1989D	probably damaging	Het
Thumpd2	T	A	17: 81,044,162	I277F	possibly damaging	Het
Tinag	C	A	9: 77,005,631	G299*	probably null	Het
Tk2	A	T	8: 104,229,299		probably null	Het
Tmem44	A	G	16: 30,540,891	S210P	possibly damaging	Het
Traf3ip1	C	A	1: 91,520,069	P423T	probably damaging	Het
Trmt12	A	G	15: 58,872,855	D34G	probably damaging	Het
Ttc39b	A	G	4: 83,261,941	Y72H	probably damaging	Het
Ttn	G	A	2: 76,878,411		probably benign	Het
Ttyh2	T	A	11: 114,710,068	I381N	possibly damaging	Het
Uaca	A	T	9: 60,870,532	N734Y	probably benign	Het
Usp34	T	C	11: 23,464,616	I2853T	probably benign	Het
Usp34	G	A	11: 23,488,659	G3407D	probably benign	Het
Vmn2r78	A	G	7: 86,921,030	Y252C	probably damaging	Het
Wdr19	G	A	5: 65,244,179	C979Y	probably damaging	Het
Wdr92	C	A	11: 17,222,220	P103Q	probably damaging	Het
Yeats2	A	T	16: 20,171,205	H277L	probably damaging	Het
Zbtb2	T	C	10: 4,369,267	Y253C	possibly damaging	Het
Zfat	C	A	15: 68,179,828	G706C	probably damaging	Het
Zfp106	A	T	2: 120,520,417	N1584K	possibly damaging	Het

Other mutations in Atp8b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Atp8b1	APN	18	64564430	missense	probably benign	0.23
IGL00907:Atp8b1	APN	18	64561705	missense	possibly damaging	0.95
IGL00962:Atp8b1	APN	18	64531444	missense	probably damaging	1.00
IGL01433:Atp8b1	APN	18	64573519	missense	probably benign	0.00
IGL01525:Atp8b1	APN	18	64539252	nonsense	probably null
IGL01645:Atp8b1	APN	18	64546113	missense	probably benign	0.06
IGL02008:Atp8b1	APN	18	64538695	splice site	probably benign
IGL02227:Atp8b1	APN	18	64562190	missense	probably benign
IGL02231:Atp8b1	APN	18	64550384	missense	possibly damaging	0.94
IGL02326:Atp8b1	APN	18	64538583	missense	probably damaging	0.99
IGL02562:Atp8b1	APN	18	64581986	missense	probably benign
IGL02929:Atp8b1	APN	18	64561662	missense	possibly damaging	0.63
enchilada	UTSW	18	64545989	critical splice donor site	probably null
PIT4520001:Atp8b1	UTSW	18	64568180	missense	probably benign	0.34
PIT4696001:Atp8b1	UTSW	18	64539270	missense	possibly damaging	0.93
R0144:Atp8b1	UTSW	18	64571374	splice site	probably benign
R0193:Atp8b1	UTSW	18	64561636	missense	probably benign
R0277:Atp8b1	UTSW	18	64568252	missense	possibly damaging	0.94
R0308:Atp8b1	UTSW	18	64545244	nonsense	probably null
R0323:Atp8b1	UTSW	18	64568252	missense	possibly damaging	0.94
R0403:Atp8b1	UTSW	18	64540310	missense	probably damaging	1.00
R0601:Atp8b1	UTSW	18	64571653	splice site	probably null
R0614:Atp8b1	UTSW	18	64533587	splice site	probably benign
R0883:Atp8b1	UTSW	18	64564541	missense	probably benign	0.44
R1077:Atp8b1	UTSW	18	64573262	nonsense	probably null
R1292:Atp8b1	UTSW	18	64571021	missense	probably damaging	0.99
R1494:Atp8b1	UTSW	18	64564526	missense	probably damaging	1.00
R1522:Atp8b1	UTSW	18	64550432	missense	probably benign	0.00
R1534:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1535:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1536:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1537:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1650:Atp8b1	UTSW	18	64571549	splice site	probably benign
R1772:Atp8b1	UTSW	18	64573492	missense	possibly damaging	0.88
R2016:Atp8b1	UTSW	18	64540334	missense	probably damaging	1.00
R2017:Atp8b1	UTSW	18	64540334	missense	probably damaging	1.00
R2043:Atp8b1	UTSW	18	64605200	missense	possibly damaging	0.94
R2223:Atp8b1	UTSW	18	64564357	missense	possibly damaging	0.88
R3052:Atp8b1	UTSW	18	64553108	missense	probably benign	0.04
R3694:Atp8b1	UTSW	18	64533721	missense	possibly damaging	0.81
R3738:Atp8b1	UTSW	18	64533729	splice site	probably benign
R4211:Atp8b1	UTSW	18	64553047	missense	probably damaging	1.00
R4362:Atp8b1	UTSW	18	64564537	missense	probably damaging	1.00
R4560:Atp8b1	UTSW	18	64556879	nonsense	probably null
R4560:Atp8b1	UTSW	18	64568247	missense	probably benign	0.11
R4562:Atp8b1	UTSW	18	64556891	missense	probably damaging	1.00
R4615:Atp8b1	UTSW	18	64553099	missense	probably null
R4676:Atp8b1	UTSW	18	64538678	missense	probably benign	0.01
R4738:Atp8b1	UTSW	18	64545180	missense	probably benign	0.31
R4774:Atp8b1	UTSW	18	64533659	missense	possibly damaging	0.49
R4808:Atp8b1	UTSW	18	64561711	missense	probably benign	0.01
R4868:Atp8b1	UTSW	18	64551866	missense	probably damaging	1.00
R5162:Atp8b1	UTSW	18	64561662	missense	possibly damaging	0.63
R5289:Atp8b1	UTSW	18	64546087	missense	possibly damaging	0.51
R5400:Atp8b1	UTSW	18	64545989	critical splice donor site	probably null
R5587:Atp8b1	UTSW	18	64539210	missense	probably damaging	1.00
R5623:Atp8b1	UTSW	18	64546094	missense	possibly damaging	0.85
R5651:Atp8b1	UTSW	18	64531382	missense	probably benign	0.31
R5652:Atp8b1	UTSW	18	64531382	missense	probably benign	0.31
R5653:Atp8b1	UTSW	18	64545197	missense	probably damaging	1.00
R5667:Atp8b1	UTSW	18	64581923	missense	probably damaging	1.00
R5689:Atp8b1	UTSW	18	64564537	missense	probably damaging	1.00
R6008:Atp8b1	UTSW	18	64577616	missense	probably damaging	1.00
R6315:Atp8b1	UTSW	18	64531479	missense	probably damaging	0.97
R6759:Atp8b1	UTSW	18	64546090	missense	probably benign	0.00
R6850:Atp8b1	UTSW	18	64556852	missense	possibly damaging	0.94
R7255:Atp8b1	UTSW	18	64556868	missense	probably damaging	1.00
R7606:Atp8b1	UTSW	18	64555115	missense	probably damaging	1.00
R7635:Atp8b1	UTSW	18	64573305	missense	possibly damaging	0.59
R7639:Atp8b1	UTSW	18	64564543	missense	possibly damaging	0.91
R7698:Atp8b1	UTSW	18	64571022	missense	probably benign	0.03
R7727:Atp8b1	UTSW	18	64545275	missense	probably damaging	1.00
R7779:Atp8b1	UTSW	18	64541382	missense	probably damaging	1.00
R7785:Atp8b1	UTSW	18	64556850	missense	probably damaging	1.00
R7874:Atp8b1	UTSW	18	64571024	missense	probably benign	0.30
R7990:Atp8b1	UTSW	18	64538677	missense	possibly damaging	0.91
R8020:Atp8b1	UTSW	18	64546013	missense	probably damaging	1.00
R8161:Atp8b1	UTSW	18	64556987	missense	probably damaging	1.00
R9007:Atp8b1	UTSW	18	64551860	missense	probably benign	0.40
R9064:Atp8b1	UTSW	18	64564420	missense	probably benign	0.12
R9266:Atp8b1	UTSW	18	64571037	missense	probably benign	0.08
R9266:Atp8b1	UTSW	18	64577457	missense	possibly damaging	0.70
R9326:Atp8b1	UTSW	18	64573273	missense	probably damaging	1.00
X0025:Atp8b1	UTSW	18	64571405	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGCTTTGCGATTGCTTAACAG -3'
(R):5'- TCTCCAGATCCAGAAGCATCG -3'

Sequencing Primer
(F):5'- ACAGCACAATCCTAGAAGTTTATTG -3'
(R):5'- TCCAGAAGCATCGAAAGCG -3'

Posted On

2016-08-04