Mutagenetix > Incidental Mutations

Incidental Mutation 'R5329:Suco'

422198

Institutional Source

Beutler Lab

Gene Symbol

Suco

Ensembl Gene

ENSMUSG00000040297

Gene Name

SUN domain containing ossification factor

Synonyms

AI848100, Opt, osteopotentia

MMRRC Submission

042911-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.764) question?

Stock #

R5329 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

161816114-161876682 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 161833430 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 967 (I967V)

Ref Sequence

ENSEMBL: ENSMUSP00000044815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048377]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048377
AA Change: I967V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000044815
Gene: ENSMUSG00000040297
AA Change: I967V

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	32	41	N/A	INTRINSIC
low complexity region	117	145	N/A	INTRINSIC
low complexity region	208	224	N/A	INTRINSIC
low complexity region	272	284	N/A	INTRINSIC
Pfam:Sad1_UNC	325	455	9e-43	PFAM
low complexity region	665	683	N/A	INTRINSIC
low complexity region	745	758	N/A	INTRINSIC
coiled coil region	933	1009	N/A	INTRINSIC
low complexity region	1014	1030	N/A	INTRINSIC
low complexity region	1105	1119	N/A	INTRINSIC
low complexity region	1163	1176	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191841

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194388

Meta Mutation Damage Score

0.1058

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (61/62)

MGI Phenotype

PHENOTYPE: Mice homozygous for a mutation in this gene display background strain-dependent neonatal and postnatal lethality, and impaired osteoblast differentiation resulting in impaired bone formation, brittle bones, and impaired fracture repair. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430005L14Rik	G	A	4: 153,959,827	V32I	probably benign	Het
Abcg4	A	T	9: 44,279,545	M19K	probably benign	Het
Acsm1	A	G	7: 119,656,051	T392A	probably benign	Het
Adam19	A	T	11: 46,125,026	I338F	probably damaging	Het
Adamdec1	C	T	14: 68,570,163	M349I	probably damaging	Het
Arhgef11	T	A	3: 87,679,752		probably benign	Het
Bptf	T	C	11: 107,073,295	D1628G	probably benign	Het
Camk2d	C	T	3: 126,597,482	Q15*	probably null	Het
Camk2g	T	G	14: 20,793,931	D12A	possibly damaging	Het
Cgn	T	C	3: 94,779,990	M1V	probably null	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Dcbld1	C	A	10: 52,284,257		probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Espl1	T	A	15: 102,312,518	L903Q	probably damaging	Het
Gm11639	T	G	11: 104,753,806		probably null	Het
Gm5117	T	A	8: 31,737,882		noncoding transcript	Het
Gm5150	T	C	3: 15,963,424	T228A	probably benign	Het
Gm5435	A	T	12: 82,496,476		noncoding transcript	Het
Gpr156	T	A	16: 38,005,448	C676S	probably benign	Het
Gstt3	C	T	10: 75,774,851	E230K	possibly damaging	Het
Jarid2	A	G	13: 44,906,271	I660V	possibly damaging	Het
Kif13a	A	G	13: 46,775,401		probably null	Het
Kntc1	T	A	5: 123,764,191	V299D	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lipk	T	A	19: 34,020,213		probably null	Het
Loxhd1	T	C	18: 77,332,682	L334P	probably damaging	Het
Macc1	T	A	12: 119,446,477	Y327N	probably damaging	Het
Man2a2	G	A	7: 80,361,128	S705L	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Ncam2	A	T	16: 81,434,819	Q57L	probably damaging	Het
Nedd1	T	C	10: 92,686,240	E645G	probably damaging	Het
Nfatc1	A	T	18: 80,708,117	M1K	probably null	Het
Nlrp9b	A	T	7: 20,023,991	R384S	probably damaging	Het
Nrxn3	A	G	12: 89,813,584	H62R	possibly damaging	Het
Olfr1097	A	G	2: 86,890,620	L185S	probably damaging	Het
Olfr1233	T	A	2: 89,339,459	Y281F	probably damaging	Het
Olfr640	T	C	7: 104,021,997	H107R	probably damaging	Het
Olfr753-ps1	T	A	17: 37,170,000	Y216F	probably damaging	Het
Olfr887	A	T	9: 38,085,126	M97L	probably benign	Het
Pdzph1	T	A	17: 58,974,880	I136F	probably damaging	Het
Pigg	T	C	5: 108,314,160	I119T	probably damaging	Het
R3hdm2	A	G	10: 127,458,893	H215R	probably damaging	Het
Sept14	C	T	5: 129,685,914		probably null	Het
Slc9a3	T	C	13: 74,150,960	M166T	possibly damaging	Het
Spock3	A	G	8: 63,345,782	D279G	probably damaging	Het
Tgtp1	A	G	11: 48,987,176	L234P	probably damaging	Het
Tmem176a	A	G	6: 48,842,217	D4G	probably benign	Het
Tmem2	T	C	19: 21,798,329	I312T	probably benign	Het
Ugt1a10	G	A	1: 88,216,254	A199T	probably damaging	Het
Uox	A	G	3: 146,624,545	D152G	probably damaging	Het
Vmn1r35	C	T	6: 66,679,506	W60*	probably null	Het
Vmn2r103	T	C	17: 19,812,171	C736R	probably damaging	Het

Other mutations in Suco

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01432:Suco	APN	1	161834120	missense	probably damaging	1.00
IGL01688:Suco	APN	1	161863911	splice site	probably null
IGL01794:Suco	APN	1	161827725	missense	probably benign	0.01
IGL01891:Suco	APN	1	161838802	missense	probably damaging	1.00
IGL02028:Suco	APN	1	161856859	missense	possibly damaging	0.95
IGL02102:Suco	APN	1	161827705	missense	probably damaging	1.00
IGL02351:Suco	APN	1	161818626	missense	probably benign	0.35
IGL02358:Suco	APN	1	161818626	missense	probably benign	0.35
IGL02392:Suco	APN	1	161834567	missense	probably benign	0.11
IGL02638:Suco	APN	1	161827687	missense	probably damaging	1.00
IGL02650:Suco	APN	1	161848753	splice site	probably benign
IGL03106:Suco	APN	1	161834480	missense	possibly damaging	0.91
IGL03189:Suco	APN	1	161857337	unclassified	probably benign
IGL03328:Suco	APN	1	161820421	missense	probably damaging	0.99
girth	UTSW	1	161828240	missense	possibly damaging	0.86
pleasingly	UTSW	1	161834408	missense	possibly damaging	0.65
3-1:Suco	UTSW	1	161822031	intron	probably benign
H8562:Suco	UTSW	1	161852851	missense	probably damaging	1.00
H8786:Suco	UTSW	1	161852851	missense	probably damaging	1.00
R0023:Suco	UTSW	1	161845585	splice site	probably null
R0023:Suco	UTSW	1	161845585	splice site	probably null
R0179:Suco	UTSW	1	161876305	splice site	probably benign
R0299:Suco	UTSW	1	161853810	missense	probably benign
R0418:Suco	UTSW	1	161834850	missense	probably benign	0.11
R0481:Suco	UTSW	1	161862313	unclassified	probably benign
R0610:Suco	UTSW	1	161859503	missense	probably benign
R0610:Suco	UTSW	1	161864032	splice site	probably benign
R0634:Suco	UTSW	1	161838804	missense	possibly damaging	0.77
R0645:Suco	UTSW	1	161834114	missense	probably damaging	1.00
R1276:Suco	UTSW	1	161857456	missense	probably benign	0.10
R1720:Suco	UTSW	1	161834054	missense	probably damaging	1.00
R1739:Suco	UTSW	1	161827655	critical splice donor site	probably null
R1763:Suco	UTSW	1	161834949	missense	possibly damaging	0.80
R1835:Suco	UTSW	1	161859500	nonsense	probably null
R1988:Suco	UTSW	1	161818811	critical splice acceptor site	probably null
R2939:Suco	UTSW	1	161848651	missense	probably damaging	1.00
R3773:Suco	UTSW	1	161843996	splice site	probably null
R3882:Suco	UTSW	1	161834744	missense	probably benign	0.33
R4193:Suco	UTSW	1	161863959	missense	probably benign	0.32
R4367:Suco	UTSW	1	161847230	missense	probably damaging	1.00
R4397:Suco	UTSW	1	161844852	missense	probably damaging	1.00
R4846:Suco	UTSW	1	161834408	missense	possibly damaging	0.65
R4851:Suco	UTSW	1	161834192	missense	probably damaging	1.00
R5224:Suco	UTSW	1	161834705	missense	probably benign	0.06
R6133:Suco	UTSW	1	161835183	nonsense	probably null
R6632:Suco	UTSW	1	161828240	missense	possibly damaging	0.86
R6643:Suco	UTSW	1	161859432	missense	possibly damaging	0.71
R7378:Suco	UTSW	1	161862211	missense	possibly damaging	0.76
R7405:Suco	UTSW	1	161828214	missense	possibly damaging	0.65
R7509:Suco	UTSW	1	161845334	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTACATTTCAGCTACAGTACTGTC -3'
(R):5'- TTGCACAGTCCTGAATTGGTC -3'

Sequencing Primer
(F):5'- GCTACAGTACTGTCTAAAAAATGTA -3'
(R):5'- GCACAGTCCTGAATTGGTCATTTAAG -3'

Posted On

2016-08-04