Mutagenetix > Incidental Mutations

Incidental Mutation 'R5329:Lin9'

422199

Institutional Source

Beutler Lab

Gene Symbol

Lin9

Ensembl Gene

ENSMUSG00000058729

Gene Name

lin-9 homolog (C. elegans)

Synonyms

2700022J23Rik

MMRRC Submission

042911-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5329 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

180641150-180690694 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 180669198 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 351 (L351I)

Ref Sequence

ENSEMBL: ENSMUSP00000141331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000193892]

Predicted Effect

probably benign
Transcript: ENSMUST00000085803
AA Change: L335I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000082959
Gene: ENSMUSG00000058729
AA Change: L335I

Domain	Start	End	E-Value	Type
DIRP	127	232	2.93e-67	SMART
coiled coil region	354	412	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000085804

SMART Domains

Protein: ENSMUSP00000082960
Gene: ENSMUSG00000058729

Domain	Start	End	E-Value	Type
DIRP	127	232	2.93e-67	SMART
coiled coil region	354	412	N/A	INTRINSIC
transmembrane domain	416	438	N/A	INTRINSIC
low complexity region	445	458	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191744

Predicted Effect

probably benign
Transcript: ENSMUST00000192561
AA Change: L351I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729
AA Change: L351I

Domain	Start	End	E-Value	Type
DIRP	143	248	2.2e-71	SMART
coiled coil region	370	428	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192725
AA Change: L311I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729
AA Change: L311I

Domain	Start	End	E-Value	Type
DIRP	103	208	2.2e-71	SMART
coiled coil region	330	388	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193892

SMART Domains

Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729

Domain	Start	End	E-Value	Type
DIRP	127	232	2.2e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194638

Meta Mutation Damage Score

0.0673

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that inhibits DNA synthesis and oncogenic transformation through association with the retinoblastoma 1 protein. The encoded protein also interacts with a complex of other cell cycle regulators to repress cell cycle-dependent gene expression in non-dividing cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show increased body weight. Mice homozygous for a gene-trap allele die shortly after implantation with defects in early embryogenesis. Homozygous deletion in adult mice causes premature death, intestinal epithelium atrophy, and abnormal mitosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430005L14Rik	G	A	4: 153,959,827	V32I	probably benign	Het
Abcg4	A	T	9: 44,279,545	M19K	probably benign	Het
Acsm1	A	G	7: 119,656,051	T392A	probably benign	Het
Adam19	A	T	11: 46,125,026	I338F	probably damaging	Het
Adamdec1	C	T	14: 68,570,163	M349I	probably damaging	Het
Arhgef11	T	A	3: 87,679,752		probably benign	Het
Bptf	T	C	11: 107,073,295	D1628G	probably benign	Het
Camk2d	C	T	3: 126,597,482	Q15*	probably null	Het
Camk2g	T	G	14: 20,793,931	D12A	possibly damaging	Het
Cgn	T	C	3: 94,779,990	M1V	probably null	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Dcbld1	C	A	10: 52,284,257		probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Espl1	T	A	15: 102,312,518	L903Q	probably damaging	Het
Gm11639	T	G	11: 104,753,806		probably null	Het
Gm5117	T	A	8: 31,737,882		noncoding transcript	Het
Gm5150	T	C	3: 15,963,424	T228A	probably benign	Het
Gm5435	A	T	12: 82,496,476		noncoding transcript	Het
Gpr156	T	A	16: 38,005,448	C676S	probably benign	Het
Gstt3	C	T	10: 75,774,851	E230K	possibly damaging	Het
Jarid2	A	G	13: 44,906,271	I660V	possibly damaging	Het
Kif13a	A	G	13: 46,775,401		probably null	Het
Kntc1	T	A	5: 123,764,191	V299D	probably benign	Het
Lipk	T	A	19: 34,020,213		probably null	Het
Loxhd1	T	C	18: 77,332,682	L334P	probably damaging	Het
Macc1	T	A	12: 119,446,477	Y327N	probably damaging	Het
Man2a2	G	A	7: 80,361,128	S705L	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Ncam2	A	T	16: 81,434,819	Q57L	probably damaging	Het
Nedd1	T	C	10: 92,686,240	E645G	probably damaging	Het
Nfatc1	A	T	18: 80,708,117	M1K	probably null	Het
Nlrp9b	A	T	7: 20,023,991	R384S	probably damaging	Het
Nrxn3	A	G	12: 89,813,584	H62R	possibly damaging	Het
Olfr1097	A	G	2: 86,890,620	L185S	probably damaging	Het
Olfr1233	T	A	2: 89,339,459	Y281F	probably damaging	Het
Olfr640	T	C	7: 104,021,997	H107R	probably damaging	Het
Olfr753-ps1	T	A	17: 37,170,000	Y216F	probably damaging	Het
Olfr887	A	T	9: 38,085,126	M97L	probably benign	Het
Pdzph1	T	A	17: 58,974,880	I136F	probably damaging	Het
Pigg	T	C	5: 108,314,160	I119T	probably damaging	Het
R3hdm2	A	G	10: 127,458,893	H215R	probably damaging	Het
Sept14	C	T	5: 129,685,914		probably null	Het
Slc9a3	T	C	13: 74,150,960	M166T	possibly damaging	Het
Spock3	A	G	8: 63,345,782	D279G	probably damaging	Het
Suco	T	C	1: 161,833,430	I967V	probably damaging	Het
Tgtp1	A	G	11: 48,987,176	L234P	probably damaging	Het
Tmem176a	A	G	6: 48,842,217	D4G	probably benign	Het
Tmem2	T	C	19: 21,798,329	I312T	probably benign	Het
Ugt1a10	G	A	1: 88,216,254	A199T	probably damaging	Het
Uox	A	G	3: 146,624,545	D152G	probably damaging	Het
Vmn1r35	C	T	6: 66,679,506	W60*	probably null	Het
Vmn2r103	T	C	17: 19,812,171	C736R	probably damaging	Het

Other mutations in Lin9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02220:Lin9	APN	1	180667367	missense	probably damaging	1.00
IGL02221:Lin9	APN	1	180650834	missense	probably benign	0.03
IGL02233:Lin9	APN	1	180689300	missense	probably damaging	0.98
IGL02370:Lin9	APN	1	180688018	missense	probably damaging	1.00
IGL02794:Lin9	APN	1	180651879	missense	probably damaging	1.00
R0278:Lin9	UTSW	1	180665923	missense	probably damaging	1.00
R1488:Lin9	UTSW	1	180688285	missense	possibly damaging	0.61
R3808:Lin9	UTSW	1	180659111	missense	probably null	0.32
R3809:Lin9	UTSW	1	180659111	missense	probably null	0.32
R3884:Lin9	UTSW	1	180688065	nonsense	probably null
R3978:Lin9	UTSW	1	180668792	missense	possibly damaging	0.94
R4600:Lin9	UTSW	1	180681194	missense	probably damaging	0.99
R4625:Lin9	UTSW	1	180689280	missense	probably damaging	0.99
R4730:Lin9	UTSW	1	180665851	nonsense	probably null
R4987:Lin9	UTSW	1	180668764	missense	probably damaging	1.00
R5034:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5035:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5045:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5046:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5148:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5180:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5181:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5221:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5222:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5332:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5633:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5634:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5696:Lin9	UTSW	1	180659081	missense	probably benign	0.00
R5812:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5813:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5814:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R5851:Lin9	UTSW	1	180669198	missense	probably benign	0.01
R7046:Lin9	UTSW	1	180667370	missense	probably damaging	1.00
R7084:Lin9	UTSW	1	180688096	missense	probably benign	0.11
R8163:Lin9	UTSW	1	180659126	missense	probably damaging	1.00
R8421:Lin9	UTSW	1	180665800	missense	probably damaging	1.00
Z1177:Lin9	UTSW	1	180650802	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- AGCTACTTCAGGACTTGAGCTAC -3'
(R):5'- TGGAAATAGCAGAGTCCTGAAAACC -3'

Sequencing Primer
(F):5'- CAGGACTTGAGCTACCAATATTATG -3'
(R):5'- GAGTCCTGAAAACCCACATAGTG -3'

Posted On

2016-08-04