Incidental Mutation 'R5329:Arhgef11'
ID422204
Institutional Source Beutler Lab
Gene Symbol Arhgef11
Ensembl Gene ENSMUSG00000041977
Gene NameRho guanine nucleotide exchange factor (GEF) 11
SynonymsPrg, PDZ-RhoGEF
MMRRC Submission 042911-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5329 (G1)
Quality Score145
Status Validated
Chromosome3
Chromosomal Location87617559-87738034 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 87679752 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039476] [ENSMUST00000129113] [ENSMUST00000152006] [ENSMUST00000212015]
Predicted Effect probably benign
Transcript: ENSMUST00000039476
SMART Domains Protein: ENSMUSP00000039900
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 681 694 N/A INTRINSIC
RhoGEF 768 952 1.11e-65 SMART
PH 996 1111 9.49e-6 SMART
low complexity region 1153 1166 N/A INTRINSIC
low complexity region 1176 1188 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1357 1367 N/A INTRINSIC
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000071536
AA Change: T83S
Predicted Effect probably benign
Transcript: ENSMUST00000129113
SMART Domains Protein: ENSMUSP00000118123
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
RGS 313 432 3.36e-11 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 652 665 N/A INTRINSIC
RhoGEF 739 923 1.11e-65 SMART
PH 967 1082 9.49e-6 SMART
low complexity region 1124 1137 N/A INTRINSIC
low complexity region 1147 1159 N/A INTRINSIC
low complexity region 1304 1314 N/A INTRINSIC
low complexity region 1328 1338 N/A INTRINSIC
low complexity region 1449 1461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142799
Predicted Effect probably benign
Transcript: ENSMUST00000152006
SMART Domains Protein: ENSMUSP00000122166
Gene: ENSMUSG00000041977

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
PDZ 55 123 2.45e-18 SMART
low complexity region 149 160 N/A INTRINSIC
coiled coil region 205 231 N/A INTRINSIC
RGS 353 472 3.36e-11 SMART
low complexity region 554 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212015
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. A similar protein in rat interacts with glutamate transporter EAAT4 and modulates its glutamate transport activity. Expression of the rat protein induces the reorganization of the actin cytoskeleton and its overexpression induces the formation of membrane ruffling and filopodia. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik G A 4: 153,959,827 V32I probably benign Het
Abcg4 A T 9: 44,279,545 M19K probably benign Het
Acsm1 A G 7: 119,656,051 T392A probably benign Het
Adam19 A T 11: 46,125,026 I338F probably damaging Het
Adamdec1 C T 14: 68,570,163 M349I probably damaging Het
Bptf T C 11: 107,073,295 D1628G probably benign Het
Camk2d C T 3: 126,597,482 Q15* probably null Het
Camk2g T G 14: 20,793,931 D12A possibly damaging Het
Cgn T C 3: 94,779,990 M1V probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Dcbld1 C A 10: 52,284,257 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Espl1 T A 15: 102,312,518 L903Q probably damaging Het
Gm11639 T G 11: 104,753,806 probably null Het
Gm5117 T A 8: 31,737,882 noncoding transcript Het
Gm5150 T C 3: 15,963,424 T228A probably benign Het
Gm5435 A T 12: 82,496,476 noncoding transcript Het
Gpr156 T A 16: 38,005,448 C676S probably benign Het
Gstt3 C T 10: 75,774,851 E230K possibly damaging Het
Jarid2 A G 13: 44,906,271 I660V possibly damaging Het
Kif13a A G 13: 46,775,401 probably null Het
Kntc1 T A 5: 123,764,191 V299D probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipk T A 19: 34,020,213 probably null Het
Loxhd1 T C 18: 77,332,682 L334P probably damaging Het
Macc1 T A 12: 119,446,477 Y327N probably damaging Het
Man2a2 G A 7: 80,361,128 S705L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Ncam2 A T 16: 81,434,819 Q57L probably damaging Het
Nedd1 T C 10: 92,686,240 E645G probably damaging Het
Nfatc1 A T 18: 80,708,117 M1K probably null Het
Nlrp9b A T 7: 20,023,991 R384S probably damaging Het
Nrxn3 A G 12: 89,813,584 H62R possibly damaging Het
Olfr1097 A G 2: 86,890,620 L185S probably damaging Het
Olfr1233 T A 2: 89,339,459 Y281F probably damaging Het
Olfr640 T C 7: 104,021,997 H107R probably damaging Het
Olfr753-ps1 T A 17: 37,170,000 Y216F probably damaging Het
Olfr887 A T 9: 38,085,126 M97L probably benign Het
Pdzph1 T A 17: 58,974,880 I136F probably damaging Het
Pigg T C 5: 108,314,160 I119T probably damaging Het
R3hdm2 A G 10: 127,458,893 H215R probably damaging Het
Sept14 C T 5: 129,685,914 probably null Het
Slc9a3 T C 13: 74,150,960 M166T possibly damaging Het
Spock3 A G 8: 63,345,782 D279G probably damaging Het
Suco T C 1: 161,833,430 I967V probably damaging Het
Tgtp1 A G 11: 48,987,176 L234P probably damaging Het
Tmem176a A G 6: 48,842,217 D4G probably benign Het
Tmem2 T C 19: 21,798,329 I312T probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Uox A G 3: 146,624,545 D152G probably damaging Het
Vmn1r35 C T 6: 66,679,506 W60* probably null Het
Vmn2r103 T C 17: 19,812,171 C736R probably damaging Het
Other mutations in Arhgef11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Arhgef11 APN 3 87729503 missense probably damaging 1.00
IGL00900:Arhgef11 APN 3 87683560 missense possibly damaging 0.71
IGL01291:Arhgef11 APN 3 87733174 missense probably benign 0.00
IGL01475:Arhgef11 APN 3 87727126 splice site probably benign
IGL01599:Arhgef11 APN 3 87737046 missense probably benign
IGL02251:Arhgef11 APN 3 87683547 missense probably damaging 1.00
IGL02651:Arhgef11 APN 3 87698864 missense probably damaging 0.99
IGL02884:Arhgef11 APN 3 87728006 missense probably damaging 1.00
IGL02900:Arhgef11 APN 3 87733160 missense probably benign 0.07
IGL03017:Arhgef11 APN 3 87717060 nonsense probably null
ANU05:Arhgef11 UTSW 3 87733174 missense probably benign 0.00
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0049:Arhgef11 UTSW 3 87729193 splice site probably null
R0129:Arhgef11 UTSW 3 87728063 missense probably damaging 1.00
R0486:Arhgef11 UTSW 3 87688852 unclassified probably null
R0698:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0701:Arhgef11 UTSW 3 87733459 missense probably benign 0.24
R0849:Arhgef11 UTSW 3 87735896 missense probably benign 0.24
R1055:Arhgef11 UTSW 3 87717118 missense probably benign 0.19
R1256:Arhgef11 UTSW 3 87727135 missense possibly damaging 0.81
R1401:Arhgef11 UTSW 3 87733469 nonsense probably null
R1543:Arhgef11 UTSW 3 87713017 missense probably benign 0.10
R1547:Arhgef11 UTSW 3 87695402 missense possibly damaging 0.87
R1564:Arhgef11 UTSW 3 87702510 missense probably benign
R1675:Arhgef11 UTSW 3 87731211 missense possibly damaging 0.84
R2082:Arhgef11 UTSW 3 87725996 missense possibly damaging 0.47
R2293:Arhgef11 UTSW 3 87727990 missense probably damaging 1.00
R4739:Arhgef11 UTSW 3 87697999 missense possibly damaging 0.47
R4930:Arhgef11 UTSW 3 87728594 missense probably damaging 1.00
R5130:Arhgef11 UTSW 3 87726014 missense possibly damaging 0.71
R5151:Arhgef11 UTSW 3 87735360 missense probably damaging 1.00
R5157:Arhgef11 UTSW 3 87728510 splice site probably null
R5203:Arhgef11 UTSW 3 87735357 missense probably damaging 1.00
R5615:Arhgef11 UTSW 3 87722485 critical splice donor site probably null
R5646:Arhgef11 UTSW 3 87684486 missense possibly damaging 0.94
R6125:Arhgef11 UTSW 3 87729602 missense probably damaging 1.00
R6242:Arhgef11 UTSW 3 87728078 missense probably benign
R6543:Arhgef11 UTSW 3 87733408 missense probably benign 0.09
R6801:Arhgef11 UTSW 3 87735852 missense possibly damaging 0.53
R6939:Arhgef11 UTSW 3 87686920 missense probably damaging 1.00
R7008:Arhgef11 UTSW 3 87729218 missense possibly damaging 0.92
R7155:Arhgef11 UTSW 3 87709572 nonsense probably null
R7169:Arhgef11 UTSW 3 87727448 missense possibly damaging 0.79
R7325:Arhgef11 UTSW 3 87713292 missense possibly damaging 0.62
R7392:Arhgef11 UTSW 3 87717175 critical splice donor site probably null
R7683:Arhgef11 UTSW 3 87722383 missense probably damaging 0.98
R7875:Arhgef11 UTSW 3 87684501 missense probably damaging 1.00
R7912:Arhgef11 UTSW 3 87733222 missense probably damaging 1.00
R7958:Arhgef11 UTSW 3 87684501 missense probably damaging 1.00
R7993:Arhgef11 UTSW 3 87733222 missense probably damaging 1.00
X0011:Arhgef11 UTSW 3 87722406 missense probably benign
Z1176:Arhgef11 UTSW 3 87735462 missense not run
Predicted Primers PCR Primer
(F):5'- GTTCTGAAGGACCTATTTTAGCTGG -3'
(R):5'- GGAAGTACGTGCTGGGATAC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- TACGTGCTGGGATACAAACAGACTC -3'
Posted On2016-08-04