Incidental Mutation 'R5329:Pigg'
ID422211
Institutional Source Beutler Lab
Gene Symbol Pigg
Ensembl Gene ENSMUSG00000029263
Gene Namephosphatidylinositol glycan anchor biosynthesis, class G
SynonymsGpi7
MMRRC Submission 042911-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5329 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108312609-108349355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108314160 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 119 (I119T)
Ref Sequence ENSEMBL: ENSMUSP00000112984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031189] [ENSMUST00000118910] [ENSMUST00000119014]
Predicted Effect probably damaging
Transcript: ENSMUST00000031189
AA Change: I119T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031189
Gene: ENSMUSG00000029263
AA Change: I119T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 68 314 6.3e-15 PFAM
transmembrane domain 428 450 N/A INTRINSIC
transmembrane domain 463 482 N/A INTRINSIC
transmembrane domain 497 519 N/A INTRINSIC
transmembrane domain 540 562 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 688 705 N/A INTRINSIC
transmembrane domain 712 734 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
transmembrane domain 785 802 N/A INTRINSIC
transmembrane domain 876 898 N/A INTRINSIC
transmembrane domain 911 933 N/A INTRINSIC
transmembrane domain 948 967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118910
AA Change: I119T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112984
Gene: ENSMUSG00000029263
AA Change: I119T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SCOP:d1eqja2 127 202 8e-8 SMART
transmembrane domain 303 325 N/A INTRINSIC
transmembrane domain 338 357 N/A INTRINSIC
transmembrane domain 372 394 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
transmembrane domain 563 580 N/A INTRINSIC
transmembrane domain 587 609 N/A INTRINSIC
transmembrane domain 624 641 N/A INTRINSIC
transmembrane domain 660 677 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 786 808 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119014
AA Change: I119T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113818
Gene: ENSMUSG00000029263
AA Change: I119T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 164 286 2.2e-9 PFAM
transmembrane domain 436 458 N/A INTRINSIC
transmembrane domain 471 490 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 548 570 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
transmembrane domain 720 742 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 793 810 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
transmembrane domain 919 941 N/A INTRINSIC
transmembrane domain 956 975 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199082
Meta Mutation Damage Score 0.8615 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in glycosylphosphatidylinositol-anchor biosynthesis. The encoded protein, which is localized to the endoplasmic reticulum, is involved in transferring ethanoloamine phosphate to mannose 2 of glycosylphosphatidylinositol species H7 to form species H8. Allelic variants of this gene have been associated with intellectual disability, hypotonia, and early-onset seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik G A 4: 153,959,827 V32I probably benign Het
Abcg4 A T 9: 44,279,545 M19K probably benign Het
Acsm1 A G 7: 119,656,051 T392A probably benign Het
Adam19 A T 11: 46,125,026 I338F probably damaging Het
Adamdec1 C T 14: 68,570,163 M349I probably damaging Het
Arhgef11 T A 3: 87,679,752 probably benign Het
Bptf T C 11: 107,073,295 D1628G probably benign Het
Camk2d C T 3: 126,597,482 Q15* probably null Het
Camk2g T G 14: 20,793,931 D12A possibly damaging Het
Cgn T C 3: 94,779,990 M1V probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Dcbld1 C A 10: 52,284,257 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Espl1 T A 15: 102,312,518 L903Q probably damaging Het
Gm11639 T G 11: 104,753,806 probably null Het
Gm5117 T A 8: 31,737,882 noncoding transcript Het
Gm5150 T C 3: 15,963,424 T228A probably benign Het
Gm5435 A T 12: 82,496,476 noncoding transcript Het
Gpr156 T A 16: 38,005,448 C676S probably benign Het
Gstt3 C T 10: 75,774,851 E230K possibly damaging Het
Jarid2 A G 13: 44,906,271 I660V possibly damaging Het
Kif13a A G 13: 46,775,401 probably null Het
Kntc1 T A 5: 123,764,191 V299D probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipk T A 19: 34,020,213 probably null Het
Loxhd1 T C 18: 77,332,682 L334P probably damaging Het
Macc1 T A 12: 119,446,477 Y327N probably damaging Het
Man2a2 G A 7: 80,361,128 S705L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Ncam2 A T 16: 81,434,819 Q57L probably damaging Het
Nedd1 T C 10: 92,686,240 E645G probably damaging Het
Nfatc1 A T 18: 80,708,117 M1K probably null Het
Nlrp9b A T 7: 20,023,991 R384S probably damaging Het
Nrxn3 A G 12: 89,813,584 H62R possibly damaging Het
Olfr1097 A G 2: 86,890,620 L185S probably damaging Het
Olfr1233 T A 2: 89,339,459 Y281F probably damaging Het
Olfr640 T C 7: 104,021,997 H107R probably damaging Het
Olfr753-ps1 T A 17: 37,170,000 Y216F probably damaging Het
Olfr887 A T 9: 38,085,126 M97L probably benign Het
Pdzph1 T A 17: 58,974,880 I136F probably damaging Het
R3hdm2 A G 10: 127,458,893 H215R probably damaging Het
Sept14 C T 5: 129,685,914 probably null Het
Slc9a3 T C 13: 74,150,960 M166T possibly damaging Het
Spock3 A G 8: 63,345,782 D279G probably damaging Het
Suco T C 1: 161,833,430 I967V probably damaging Het
Tgtp1 A G 11: 48,987,176 L234P probably damaging Het
Tmem176a A G 6: 48,842,217 D4G probably benign Het
Tmem2 T C 19: 21,798,329 I312T probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Uox A G 3: 146,624,545 D152G probably damaging Het
Vmn1r35 C T 6: 66,679,506 W60* probably null Het
Vmn2r103 T C 17: 19,812,171 C736R probably damaging Het
Other mutations in Pigg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Pigg APN 5 108342078 missense probably damaging 1.00
IGL01308:Pigg APN 5 108336477 missense probably damaging 1.00
IGL01485:Pigg APN 5 108336201 missense possibly damaging 0.90
IGL02043:Pigg APN 5 108344324 missense probably damaging 1.00
IGL02104:Pigg APN 5 108342097 missense probably damaging 1.00
IGL02238:Pigg APN 5 108318928 missense possibly damaging 0.64
IGL02311:Pigg APN 5 108336380 missense probably benign
IGL02608:Pigg APN 5 108313003 missense probably damaging 0.98
IGL03338:Pigg APN 5 108319950 missense probably damaging 1.00
P0033:Pigg UTSW 5 108342078 missense probably damaging 1.00
R0082:Pigg UTSW 5 108312885 start gained probably benign
R0449:Pigg UTSW 5 108336411 missense probably benign 0.00
R0616:Pigg UTSW 5 108314085 missense probably damaging 1.00
R1246:Pigg UTSW 5 108341820 missense probably damaging 0.99
R1368:Pigg UTSW 5 108317288 missense probably damaging 1.00
R1777:Pigg UTSW 5 108317391 missense probably damaging 1.00
R1898:Pigg UTSW 5 108336542 missense probably benign
R2022:Pigg UTSW 5 108312922 start gained probably benign
R2037:Pigg UTSW 5 108338652 missense probably damaging 1.00
R2157:Pigg UTSW 5 108318889 missense probably damaging 1.00
R2181:Pigg UTSW 5 108336500 missense probably damaging 0.96
R2291:Pigg UTSW 5 108332917 missense probably damaging 0.97
R3157:Pigg UTSW 5 108314148 missense probably damaging 1.00
R4117:Pigg UTSW 5 108348042 missense probably benign 0.15
R4572:Pigg UTSW 5 108332885 missense probably benign 0.27
R4589:Pigg UTSW 5 108332690 missense probably benign
R5019:Pigg UTSW 5 108332149 missense probably damaging 1.00
R5094:Pigg UTSW 5 108336257 missense possibly damaging 0.90
R5960:Pigg UTSW 5 108336294 missense probably benign 0.01
R5976:Pigg UTSW 5 108332191 missense probably null 1.00
R6089:Pigg UTSW 5 108341922 missense probably benign
R6797:Pigg UTSW 5 108332828 missense probably damaging 0.99
R6960:Pigg UTSW 5 108326841 missense probably damaging 0.98
R7090:Pigg UTSW 5 108336512 missense possibly damaging 0.92
R7659:Pigg UTSW 5 108338619 missense probably benign 0.03
R7660:Pigg UTSW 5 108338619 missense probably benign 0.03
R7661:Pigg UTSW 5 108338619 missense probably benign 0.03
R7732:Pigg UTSW 5 108318975 missense probably benign 0.00
R7749:Pigg UTSW 5 108336296 missense probably benign
R7765:Pigg UTSW 5 108314054 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCGAACTGGACCAAGCTGC -3'
(R):5'- GAGGGATGAACTTCAGCTACTTAAC -3'

Sequencing Primer
(F):5'- CCACCACCTCTCTTCAGTAAAGTGG -3'
(R):5'- ACTTCAGCTACTTAACAAGGGG -3'
Posted On2016-08-04