Incidental Mutation 'R5329:Acsm1'
ID422219
Institutional Source Beutler Lab
Gene Symbol Acsm1
Ensembl Gene ENSMUSG00000033533
Gene Nameacyl-CoA synthetase medium-chain family member 1
SynonymsBucs1, Macs
MMRRC Submission 042911-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5329 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119607026-119662515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119656051 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 392 (T392A)
Ref Sequence ENSEMBL: ENSMUSP00000120146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047929] [ENSMUST00000135683]
Predicted Effect probably benign
Transcript: ENSMUST00000047929
AA Change: T419A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000036140
Gene: ENSMUSG00000033533
AA Change: T419A

DomainStartEndE-ValueType
Pfam:AMP-binding 58 471 8.1e-70 PFAM
Pfam:AMP-binding_C 479 559 1.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135683
AA Change: T392A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120146
Gene: ENSMUSG00000033533
AA Change: T392A

DomainStartEndE-ValueType
Pfam:AMP-binding 58 371 6.8e-51 PFAM
Pfam:AMP-binding 368 444 9e-15 PFAM
Pfam:AMP-binding_C 452 531 5.4e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik G A 4: 153,959,827 V32I probably benign Het
Abcg4 A T 9: 44,279,545 M19K probably benign Het
Adam19 A T 11: 46,125,026 I338F probably damaging Het
Adamdec1 C T 14: 68,570,163 M349I probably damaging Het
Arhgef11 T A 3: 87,679,752 probably benign Het
Bptf T C 11: 107,073,295 D1628G probably benign Het
Camk2d C T 3: 126,597,482 Q15* probably null Het
Camk2g T G 14: 20,793,931 D12A possibly damaging Het
Cgn T C 3: 94,779,990 M1V probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Dcbld1 C A 10: 52,284,257 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Espl1 T A 15: 102,312,518 L903Q probably damaging Het
Gm11639 T G 11: 104,753,806 probably null Het
Gm5117 T A 8: 31,737,882 noncoding transcript Het
Gm5150 T C 3: 15,963,424 T228A probably benign Het
Gm5435 A T 12: 82,496,476 noncoding transcript Het
Gpr156 T A 16: 38,005,448 C676S probably benign Het
Gstt3 C T 10: 75,774,851 E230K possibly damaging Het
Jarid2 A G 13: 44,906,271 I660V possibly damaging Het
Kif13a A G 13: 46,775,401 probably null Het
Kntc1 T A 5: 123,764,191 V299D probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipk T A 19: 34,020,213 probably null Het
Loxhd1 T C 18: 77,332,682 L334P probably damaging Het
Macc1 T A 12: 119,446,477 Y327N probably damaging Het
Man2a2 G A 7: 80,361,128 S705L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Ncam2 A T 16: 81,434,819 Q57L probably damaging Het
Nedd1 T C 10: 92,686,240 E645G probably damaging Het
Nfatc1 A T 18: 80,708,117 M1K probably null Het
Nlrp9b A T 7: 20,023,991 R384S probably damaging Het
Nrxn3 A G 12: 89,813,584 H62R possibly damaging Het
Olfr1097 A G 2: 86,890,620 L185S probably damaging Het
Olfr1233 T A 2: 89,339,459 Y281F probably damaging Het
Olfr640 T C 7: 104,021,997 H107R probably damaging Het
Olfr753-ps1 T A 17: 37,170,000 Y216F probably damaging Het
Olfr887 A T 9: 38,085,126 M97L probably benign Het
Pdzph1 T A 17: 58,974,880 I136F probably damaging Het
Pigg T C 5: 108,314,160 I119T probably damaging Het
R3hdm2 A G 10: 127,458,893 H215R probably damaging Het
Sept14 C T 5: 129,685,914 probably null Het
Slc9a3 T C 13: 74,150,960 M166T possibly damaging Het
Spock3 A G 8: 63,345,782 D279G probably damaging Het
Suco T C 1: 161,833,430 I967V probably damaging Het
Tgtp1 A G 11: 48,987,176 L234P probably damaging Het
Tmem176a A G 6: 48,842,217 D4G probably benign Het
Tmem2 T C 19: 21,798,329 I312T probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Uox A G 3: 146,624,545 D152G probably damaging Het
Vmn1r35 C T 6: 66,679,506 W60* probably null Het
Vmn2r103 T C 17: 19,812,171 C736R probably damaging Het
Other mutations in Acsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Acsm1 APN 7 119658301 missense possibly damaging 0.46
IGL02121:Acsm1 APN 7 119658412 missense possibly damaging 0.76
IGL02480:Acsm1 APN 7 119656042 missense possibly damaging 0.94
IGL02806:Acsm1 APN 7 119636638 missense probably benign 0.02
IGL03126:Acsm1 APN 7 119633180 missense possibly damaging 0.74
wallball UTSW 7 119640694 missense possibly damaging 0.83
R0025:Acsm1 UTSW 7 119658315 missense probably damaging 1.00
R0025:Acsm1 UTSW 7 119658315 missense probably damaging 1.00
R0090:Acsm1 UTSW 7 119662189 splice site probably benign
R0396:Acsm1 UTSW 7 119636455 missense probably damaging 1.00
R0491:Acsm1 UTSW 7 119640697 missense probably damaging 1.00
R0575:Acsm1 UTSW 7 119659201 critical splice donor site probably null
R1220:Acsm1 UTSW 7 119658314 missense probably benign 0.00
R1366:Acsm1 UTSW 7 119658288 splice site probably benign
R1624:Acsm1 UTSW 7 119652573 missense probably damaging 1.00
R2049:Acsm1 UTSW 7 119656039 missense probably damaging 1.00
R2937:Acsm1 UTSW 7 119659127 missense probably damaging 1.00
R4657:Acsm1 UTSW 7 119640694 missense possibly damaging 0.83
R4814:Acsm1 UTSW 7 119655464 missense probably benign
R5153:Acsm1 UTSW 7 119640727 missense possibly damaging 0.72
R5471:Acsm1 UTSW 7 119660606 missense probably damaging 1.00
R5645:Acsm1 UTSW 7 119640697 missense probably damaging 1.00
R6153:Acsm1 UTSW 7 119633066 missense probably damaging 1.00
R6406:Acsm1 UTSW 7 119662261 missense probably benign 0.01
R7068:Acsm1 UTSW 7 119622580 missense probably benign
R7311:Acsm1 UTSW 7 119638082 missense probably damaging 1.00
Z1177:Acsm1 UTSW 7 119662278 missense not run
Predicted Primers PCR Primer
(F):5'- ACGGTTTGTCCATGAGTAGG -3'
(R):5'- TAGCTCTTAAATCCCCAAGTGG -3'

Sequencing Primer
(F):5'- ATGAGTAGGTCCCATTTGCC -3'
(R):5'- AGGACTGTGACAATGTGCC -3'
Posted On2016-08-04