Mutagenetix > Incidental Mutations

Incidental Mutation 'R5329:Gm5117'

422220

Institutional Source

Beutler Lab

Gene Symbol

Gm5117

Ensembl Gene

ENSMUSG00000093862

Gene Name

predicted gene 5117

Synonyms

MMRRC Submission

042911-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.847) question?

Stock #

R5329 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31737208-31739760 bp(-) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

T to A at 31737882 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000178878

SMART Domains

Protein: ENSMUSP00000137046
Gene: ENSMUSG00000093862

Domain	Start	End	E-Value	Type
low complexity region	147	158	N/A	INTRINSIC
low complexity region	608	627	N/A	INTRINSIC
Pfam:Met_10	666	799	1.5e-9	PFAM
Pfam:UPF0020	672	770	4e-8	PFAM
Pfam:Methyltransf_18	687	815	5e-10	PFAM
Pfam:Methyltransf_31	688	801	1.5e-10	PFAM
Pfam:Methyltransf_26	688	803	1e-8	PFAM
Pfam:Methyltransf_15	688	842	5e-48	PFAM

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (61/62)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430005L14Rik	G	A	4: 153,959,827	V32I	probably benign	Het
Abcg4	A	T	9: 44,279,545	M19K	probably benign	Het
Acsm1	A	G	7: 119,656,051	T392A	probably benign	Het
Adam19	A	T	11: 46,125,026	I338F	probably damaging	Het
Adamdec1	C	T	14: 68,570,163	M349I	probably damaging	Het
Arhgef11	T	A	3: 87,679,752		probably benign	Het
Bptf	T	C	11: 107,073,295	D1628G	probably benign	Het
Camk2d	C	T	3: 126,597,482	Q15*	probably null	Het
Camk2g	T	G	14: 20,793,931	D12A	possibly damaging	Het
Cgn	T	C	3: 94,779,990	M1V	probably null	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Dcbld1	C	A	10: 52,284,257		probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Espl1	T	A	15: 102,312,518	L903Q	probably damaging	Het
Gm11639	T	G	11: 104,753,806		probably null	Het
Gm5150	T	C	3: 15,963,424	T228A	probably benign	Het
Gm5435	A	T	12: 82,496,476		noncoding transcript	Het
Gpr156	T	A	16: 38,005,448	C676S	probably benign	Het
Gstt3	C	T	10: 75,774,851	E230K	possibly damaging	Het
Jarid2	A	G	13: 44,906,271	I660V	possibly damaging	Het
Kif13a	A	G	13: 46,775,401		probably null	Het
Kntc1	T	A	5: 123,764,191	V299D	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lipk	T	A	19: 34,020,213		probably null	Het
Loxhd1	T	C	18: 77,332,682	L334P	probably damaging	Het
Macc1	T	A	12: 119,446,477	Y327N	probably damaging	Het
Man2a2	G	A	7: 80,361,128	S705L	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Ncam2	A	T	16: 81,434,819	Q57L	probably damaging	Het
Nedd1	T	C	10: 92,686,240	E645G	probably damaging	Het
Nfatc1	A	T	18: 80,708,117	M1K	probably null	Het
Nlrp9b	A	T	7: 20,023,991	R384S	probably damaging	Het
Nrxn3	A	G	12: 89,813,584	H62R	possibly damaging	Het
Olfr1097	A	G	2: 86,890,620	L185S	probably damaging	Het
Olfr1233	T	A	2: 89,339,459	Y281F	probably damaging	Het
Olfr640	T	C	7: 104,021,997	H107R	probably damaging	Het
Olfr753-ps1	T	A	17: 37,170,000	Y216F	probably damaging	Het
Olfr887	A	T	9: 38,085,126	M97L	probably benign	Het
Pdzph1	T	A	17: 58,974,880	I136F	probably damaging	Het
Pigg	T	C	5: 108,314,160	I119T	probably damaging	Het
R3hdm2	A	G	10: 127,458,893	H215R	probably damaging	Het
Sept14	C	T	5: 129,685,914		probably null	Het
Slc9a3	T	C	13: 74,150,960	M166T	possibly damaging	Het
Spock3	A	G	8: 63,345,782	D279G	probably damaging	Het
Suco	T	C	1: 161,833,430	I967V	probably damaging	Het
Tgtp1	A	G	11: 48,987,176	L234P	probably damaging	Het
Tmem176a	A	G	6: 48,842,217	D4G	probably benign	Het
Tmem2	T	C	19: 21,798,329	I312T	probably benign	Het
Ugt1a10	G	A	1: 88,216,254	A199T	probably damaging	Het
Uox	A	G	3: 146,624,545	D152G	probably damaging	Het
Vmn1r35	C	T	6: 66,679,506	W60*	probably null	Het
Vmn2r103	T	C	17: 19,812,171	C736R	probably damaging	Het

Other mutations in Gm5117

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL01022:Gm5117	APN	8	31738487	exon	noncoding transcript
IGL01362:Gm5117	APN	8	31737919	exon	noncoding transcript
IGL01972:Gm5117	APN	8	31737759	exon	noncoding transcript
IGL02100:Gm5117	APN	8	31737384	exon	noncoding transcript
IGL02339:Gm5117	APN	8	31738226	exon	noncoding transcript
IGL02366:Gm5117	APN	8	31737859	exon	noncoding transcript
IGL02505:Gm5117	APN	8	31738316	exon	noncoding transcript
IGL02698:Gm5117	APN	8	31739739	exon	noncoding transcript
IGL03310:Gm5117	APN	8	31738808	exon	noncoding transcript
IGL02835:Gm5117	UTSW	8	31737170	unclassified	noncoding transcript
R1816:Gm5117	UTSW	8	31738958	exon	noncoding transcript
R2157:Gm5117	UTSW	8	31738194	exon	noncoding transcript
R2353:Gm5117	UTSW	8	31739195	exon	noncoding transcript
R2404:Gm5117	UTSW	8	31737278	exon	noncoding transcript
R2408:Gm5117	UTSW	8	31737278	exon	noncoding transcript
R2409:Gm5117	UTSW	8	31737278	exon	noncoding transcript
R2510:Gm5117	UTSW	8	31738355	exon	noncoding transcript
R4686:Gm5117	UTSW	8	31739256	exon	noncoding transcript
R4953:Gm5117	UTSW	8	31738580	exon	noncoding transcript
R5244:Gm5117	UTSW	8	31738277	exon	noncoding transcript
R5275:Gm5117	UTSW	8	31739567	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- AACGTCACATCTGAAGGCCC -3'
(R):5'- TCCAGAACCTGAGAAATGTCAG -3'

Sequencing Primer
(F):5'- TCACATCTGAAGGCCCGACTG -3'
(R):5'- GAAATGTCAGACCATCTTTTCAGCC -3'

Posted On

2016-08-04