Incidental Mutation 'R5329:Abcg4'
ID422225
Institutional Source Beutler Lab
Gene Symbol Abcg4
Ensembl Gene ENSMUSG00000032131
Gene NameATP binding cassette subfamily G member 4
Synonyms6430517O04Rik
MMRRC Submission 042911-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5329 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44273188-44288615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44279545 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 19 (M19K)
Ref Sequence ENSEMBL: ENSMUSP00000123999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034648] [ENSMUST00000160384] [ENSMUST00000161354] [ENSMUST00000161408] [ENSMUST00000162783]
Predicted Effect probably benign
Transcript: ENSMUST00000034648
AA Change: M267K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034648
Gene: ENSMUSG00000032131
AA Change: M267K

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 1.6e-49 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160323
Predicted Effect probably benign
Transcript: ENSMUST00000160384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161206
Predicted Effect probably benign
Transcript: ENSMUST00000161354
AA Change: M267K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124647
Gene: ENSMUSG00000032131
AA Change: M267K

DomainStartEndE-ValueType
AAA 94 285 4.46e-14 SMART
Pfam:ABC2_membrane 372 583 4.8e-47 PFAM
transmembrane domain 616 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161408
Predicted Effect probably benign
Transcript: ENSMUST00000162783
AA Change: M19K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123999
Gene: ENSMUSG00000032131
AA Change: M19K

DomainStartEndE-ValueType
Blast:AAA 1 37 9e-20 BLAST
SCOP:d1gcya2 33 64 1e-2 SMART
Meta Mutation Damage Score 0.1424 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein is a member of the White subfamily and plays an important role in cellular cholesterol homeostasis. This protein functions as either a homodimer or as a heterodimer with another ABC subfamily protein such as ABCG1. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a report allele exhibit increased brain lathosterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik G A 4: 153,959,827 V32I probably benign Het
Acsm1 A G 7: 119,656,051 T392A probably benign Het
Adam19 A T 11: 46,125,026 I338F probably damaging Het
Adamdec1 C T 14: 68,570,163 M349I probably damaging Het
Arhgef11 T A 3: 87,679,752 probably benign Het
Bptf T C 11: 107,073,295 D1628G probably benign Het
Camk2d C T 3: 126,597,482 Q15* probably null Het
Camk2g T G 14: 20,793,931 D12A possibly damaging Het
Cgn T C 3: 94,779,990 M1V probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Dcbld1 C A 10: 52,284,257 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Espl1 T A 15: 102,312,518 L903Q probably damaging Het
Gm11639 T G 11: 104,753,806 probably null Het
Gm5117 T A 8: 31,737,882 noncoding transcript Het
Gm5150 T C 3: 15,963,424 T228A probably benign Het
Gm5435 A T 12: 82,496,476 noncoding transcript Het
Gpr156 T A 16: 38,005,448 C676S probably benign Het
Gstt3 C T 10: 75,774,851 E230K possibly damaging Het
Jarid2 A G 13: 44,906,271 I660V possibly damaging Het
Kif13a A G 13: 46,775,401 probably null Het
Kntc1 T A 5: 123,764,191 V299D probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipk T A 19: 34,020,213 probably null Het
Loxhd1 T C 18: 77,332,682 L334P probably damaging Het
Macc1 T A 12: 119,446,477 Y327N probably damaging Het
Man2a2 G A 7: 80,361,128 S705L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Ncam2 A T 16: 81,434,819 Q57L probably damaging Het
Nedd1 T C 10: 92,686,240 E645G probably damaging Het
Nfatc1 A T 18: 80,708,117 M1K probably null Het
Nlrp9b A T 7: 20,023,991 R384S probably damaging Het
Nrxn3 A G 12: 89,813,584 H62R possibly damaging Het
Olfr1097 A G 2: 86,890,620 L185S probably damaging Het
Olfr1233 T A 2: 89,339,459 Y281F probably damaging Het
Olfr640 T C 7: 104,021,997 H107R probably damaging Het
Olfr753-ps1 T A 17: 37,170,000 Y216F probably damaging Het
Olfr887 A T 9: 38,085,126 M97L probably benign Het
Pdzph1 T A 17: 58,974,880 I136F probably damaging Het
Pigg T C 5: 108,314,160 I119T probably damaging Het
R3hdm2 A G 10: 127,458,893 H215R probably damaging Het
Sept14 C T 5: 129,685,914 probably null Het
Slc9a3 T C 13: 74,150,960 M166T possibly damaging Het
Spock3 A G 8: 63,345,782 D279G probably damaging Het
Suco T C 1: 161,833,430 I967V probably damaging Het
Tgtp1 A G 11: 48,987,176 L234P probably damaging Het
Tmem176a A G 6: 48,842,217 D4G probably benign Het
Tmem2 T C 19: 21,798,329 I312T probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Uox A G 3: 146,624,545 D152G probably damaging Het
Vmn1r35 C T 6: 66,679,506 W60* probably null Het
Vmn2r103 T C 17: 19,812,171 C736R probably damaging Het
Other mutations in Abcg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Abcg4 APN 9 44275142 splice site probably benign
IGL00585:Abcg4 APN 9 44281623 missense probably benign 0.04
IGL02016:Abcg4 APN 9 44287350 missense probably damaging 0.99
IGL02085:Abcg4 APN 9 44281557 critical splice donor site probably null
IGL02142:Abcg4 APN 9 44277717 missense probably benign 0.18
IGL02171:Abcg4 APN 9 44275009 unclassified probably benign
IGL02309:Abcg4 APN 9 44281828 missense probably benign 0.21
IGL02882:Abcg4 APN 9 44277489 nonsense probably null
R0009:Abcg4 UTSW 9 44277649 splice site probably benign
R0023:Abcg4 UTSW 9 44275375 missense probably damaging 0.99
R0481:Abcg4 UTSW 9 44279369 missense probably benign 0.07
R0513:Abcg4 UTSW 9 44281687 missense possibly damaging 0.61
R0644:Abcg4 UTSW 9 44274699 missense possibly damaging 0.87
R0649:Abcg4 UTSW 9 44278033 missense probably benign 0.00
R1084:Abcg4 UTSW 9 44277469 missense probably benign 0.27
R1518:Abcg4 UTSW 9 44275369 missense probably benign 0.05
R1528:Abcg4 UTSW 9 44274723 missense probably damaging 0.99
R1702:Abcg4 UTSW 9 44275073 missense probably damaging 0.99
R1932:Abcg4 UTSW 9 44279394 missense probably benign 0.16
R4477:Abcg4 UTSW 9 44275086 missense probably damaging 1.00
R4661:Abcg4 UTSW 9 44287330 missense probably damaging 1.00
R4883:Abcg4 UTSW 9 44279319 missense probably damaging 1.00
R4901:Abcg4 UTSW 9 44277657 critical splice donor site probably null
R5039:Abcg4 UTSW 9 44281566 missense probably damaging 1.00
R5209:Abcg4 UTSW 9 44275375 missense probably damaging 0.99
R5492:Abcg4 UTSW 9 44278058 missense probably benign 0.01
R5521:Abcg4 UTSW 9 44279683 unclassified probably benign
R5558:Abcg4 UTSW 9 44281408 missense probably damaging 0.99
R5625:Abcg4 UTSW 9 44278036 missense probably benign 0.42
R6318:Abcg4 UTSW 9 44275348 missense probably benign
R7060:Abcg4 UTSW 9 44275128 missense probably benign 0.13
R7129:Abcg4 UTSW 9 44279384 missense probably benign 0.03
R7431:Abcg4 UTSW 9 44274700 missense possibly damaging 0.87
R7452:Abcg4 UTSW 9 44279600 missense probably damaging 1.00
X0028:Abcg4 UTSW 9 44274634 makesense probably null
Predicted Primers PCR Primer
(F):5'- CCTTCAGATAGGGAATCAGGTTG -3'
(R):5'- TCCATCCCTTTCACAGAAGC -3'

Sequencing Primer
(F):5'- TGGTAACCACGCCCTTGAAGATG -3'
(R):5'- TTTCACAGAAGCCGCCC -3'
Posted On2016-08-04