Incidental Mutation 'R5329:Nedd1'
ID422228
Institutional Source Beutler Lab
Gene Symbol Nedd1
Ensembl Gene ENSMUSG00000019988
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 1
Synonyms
MMRRC Submission 042911-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5329 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location92684746-92722420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92686240 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 645 (E645G)
Ref Sequence ENSEMBL: ENSMUSP00000020163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020163]
Predicted Effect probably damaging
Transcript: ENSMUST00000020163
AA Change: E645G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988
AA Change: E645G

DomainStartEndE-ValueType
WD40 21 63 5.97e-1 SMART
WD40 67 105 9.75e-3 SMART
WD40 108 147 6.19e-5 SMART
WD40 149 191 6.42e-1 SMART
WD40 194 235 9.1e-3 SMART
WD40 238 276 2.24e-2 SMART
low complexity region 555 568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157787
Meta Mutation Damage Score 0.1413 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik G A 4: 153,959,827 V32I probably benign Het
Abcg4 A T 9: 44,279,545 M19K probably benign Het
Acsm1 A G 7: 119,656,051 T392A probably benign Het
Adam19 A T 11: 46,125,026 I338F probably damaging Het
Adamdec1 C T 14: 68,570,163 M349I probably damaging Het
Arhgef11 T A 3: 87,679,752 probably benign Het
Bptf T C 11: 107,073,295 D1628G probably benign Het
Camk2d C T 3: 126,597,482 Q15* probably null Het
Camk2g T G 14: 20,793,931 D12A possibly damaging Het
Cgn T C 3: 94,779,990 M1V probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Dcbld1 C A 10: 52,284,257 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Espl1 T A 15: 102,312,518 L903Q probably damaging Het
Gm11639 T G 11: 104,753,806 probably null Het
Gm5117 T A 8: 31,737,882 noncoding transcript Het
Gm5150 T C 3: 15,963,424 T228A probably benign Het
Gm5435 A T 12: 82,496,476 noncoding transcript Het
Gpr156 T A 16: 38,005,448 C676S probably benign Het
Gstt3 C T 10: 75,774,851 E230K possibly damaging Het
Jarid2 A G 13: 44,906,271 I660V possibly damaging Het
Kif13a A G 13: 46,775,401 probably null Het
Kntc1 T A 5: 123,764,191 V299D probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipk T A 19: 34,020,213 probably null Het
Loxhd1 T C 18: 77,332,682 L334P probably damaging Het
Macc1 T A 12: 119,446,477 Y327N probably damaging Het
Man2a2 G A 7: 80,361,128 S705L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Ncam2 A T 16: 81,434,819 Q57L probably damaging Het
Nfatc1 A T 18: 80,708,117 M1K probably null Het
Nlrp9b A T 7: 20,023,991 R384S probably damaging Het
Nrxn3 A G 12: 89,813,584 H62R possibly damaging Het
Olfr1097 A G 2: 86,890,620 L185S probably damaging Het
Olfr1233 T A 2: 89,339,459 Y281F probably damaging Het
Olfr640 T C 7: 104,021,997 H107R probably damaging Het
Olfr753-ps1 T A 17: 37,170,000 Y216F probably damaging Het
Olfr887 A T 9: 38,085,126 M97L probably benign Het
Pdzph1 T A 17: 58,974,880 I136F probably damaging Het
Pigg T C 5: 108,314,160 I119T probably damaging Het
R3hdm2 A G 10: 127,458,893 H215R probably damaging Het
Sept14 C T 5: 129,685,914 probably null Het
Slc9a3 T C 13: 74,150,960 M166T possibly damaging Het
Spock3 A G 8: 63,345,782 D279G probably damaging Het
Suco T C 1: 161,833,430 I967V probably damaging Het
Tgtp1 A G 11: 48,987,176 L234P probably damaging Het
Tmem176a A G 6: 48,842,217 D4G probably benign Het
Tmem2 T C 19: 21,798,329 I312T probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Uox A G 3: 146,624,545 D152G probably damaging Het
Vmn1r35 C T 6: 66,679,506 W60* probably null Het
Vmn2r103 T C 17: 19,812,171 C736R probably damaging Het
Other mutations in Nedd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Nedd1 APN 10 92694974 splice site probably benign
IGL00988:Nedd1 APN 10 92689686 missense possibly damaging 0.71
IGL01563:Nedd1 APN 10 92698169 critical splice donor site probably null
IGL01588:Nedd1 APN 10 92686262 missense probably benign 0.12
IGL01988:Nedd1 APN 10 92714159 missense probably benign 0.39
IGL02706:Nedd1 APN 10 92686285 missense possibly damaging 0.88
IGL02938:Nedd1 APN 10 92689657 nonsense probably null
IGL03011:Nedd1 APN 10 92689641 missense possibly damaging 0.92
Brainless UTSW 10 92690773 missense probably benign 0.01
R0125:Nedd1 UTSW 10 92691929 missense possibly damaging 0.93
R0173:Nedd1 UTSW 10 92698883 missense probably benign 0.30
R0244:Nedd1 UTSW 10 92716265 intron probably benign
R0645:Nedd1 UTSW 10 92691831 splice site probably null
R0791:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1490:Nedd1 UTSW 10 92700798 missense probably damaging 1.00
R1522:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1797:Nedd1 UTSW 10 92698739 missense possibly damaging 0.46
R1984:Nedd1 UTSW 10 92714160 missense possibly damaging 0.63
R2474:Nedd1 UTSW 10 92719603 missense probably damaging 0.99
R2877:Nedd1 UTSW 10 92714126 missense possibly damaging 0.89
R2883:Nedd1 UTSW 10 92694998 missense probably damaging 0.98
R4694:Nedd1 UTSW 10 92719582 missense probably benign 0.00
R4798:Nedd1 UTSW 10 92698910 missense probably benign 0.00
R4830:Nedd1 UTSW 10 92686258 missense probably damaging 1.00
R4963:Nedd1 UTSW 10 92695031 missense probably damaging 1.00
R5174:Nedd1 UTSW 10 92711212 missense possibly damaging 0.77
R5404:Nedd1 UTSW 10 92716192 missense probably benign 0.04
R5534:Nedd1 UTSW 10 92695032 missense probably benign 0.01
R6045:Nedd1 UTSW 10 92695100 nonsense probably null
R6154:Nedd1 UTSW 10 92698242 missense possibly damaging 0.65
R6512:Nedd1 UTSW 10 92691875 missense probably benign
R6692:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6693:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6943:Nedd1 UTSW 10 92711306 missense probably damaging 1.00
R7011:Nedd1 UTSW 10 92690773 missense probably benign 0.01
R7455:Nedd1 UTSW 10 92700925 missense probably benign 0.01
R7587:Nedd1 UTSW 10 92698730 missense probably benign 0.01
R7745:Nedd1 UTSW 10 92714172 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATGGAATAGTGCGTGCTG -3'
(R):5'- AAAGTATGACTGTAGATCTCCCCG -3'

Sequencing Primer
(F):5'- GTGCTGCAAAATCCACTTTCAAGG -3'
(R):5'- TCCTGGTTAGGTCCAAGGAATACC -3'
Posted On2016-08-04