Incidental Mutation 'R5329:R3hdm2'
ID422229
Institutional Source Beutler Lab
Gene Symbol R3hdm2
Ensembl Gene ENSMUSG00000025404
Gene NameR3H domain containing 2
Synonyms
MMRRC Submission 042911-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock #R5329 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127380327-127499384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127458893 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 215 (H215R)
Ref Sequence ENSEMBL: ENSMUSP00000128659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064793] [ENSMUST00000077046] [ENSMUST00000105249] [ENSMUST00000105250] [ENSMUST00000105251] [ENSMUST00000164161] [ENSMUST00000164831] [ENSMUST00000165440] [ENSMUST00000166820] [ENSMUST00000169888] [ENSMUST00000170336]
Predicted Effect probably damaging
Transcript: ENSMUST00000064793
AA Change: H215R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069724
Gene: ENSMUSG00000025404
AA Change: H215R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 699 730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077046
AA Change: H215R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076303
Gene: ENSMUSG00000025404
AA Change: H215R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 7.4e-14 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105249
AA Change: H215R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100884
Gene: ENSMUSG00000025404
AA Change: H215R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.4e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 692 723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105250
AA Change: H215R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100885
Gene: ENSMUSG00000025404
AA Change: H215R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105251
AA Change: H215R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100886
Gene: ENSMUSG00000025404
AA Change: H215R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163794
Predicted Effect probably benign
Transcript: ENSMUST00000164161
SMART Domains Protein: ENSMUSP00000126185
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164831
AA Change: H215R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131007
Gene: ENSMUSG00000025404
AA Change: H215R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 678 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165440
SMART Domains Protein: ENSMUSP00000133118
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
Pfam:SUZ 17 64 1.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166820
AA Change: H215R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126608
Gene: ENSMUSG00000025404
AA Change: H215R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.7e-12 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169888
SMART Domains Protein: ENSMUSP00000126760
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
Pfam:SUZ 7 54 4.7e-12 PFAM
low complexity region 71 83 N/A INTRINSIC
low complexity region 163 194 N/A INTRINSIC
low complexity region 443 474 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170336
AA Change: H215R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128659
Gene: ENSMUSG00000025404
AA Change: H215R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 467 N/A INTRINSIC
low complexity region 712 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171823
Meta Mutation Damage Score 0.9384 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik G A 4: 153,959,827 V32I probably benign Het
Abcg4 A T 9: 44,279,545 M19K probably benign Het
Acsm1 A G 7: 119,656,051 T392A probably benign Het
Adam19 A T 11: 46,125,026 I338F probably damaging Het
Adamdec1 C T 14: 68,570,163 M349I probably damaging Het
Arhgef11 T A 3: 87,679,752 probably benign Het
Bptf T C 11: 107,073,295 D1628G probably benign Het
Camk2d C T 3: 126,597,482 Q15* probably null Het
Camk2g T G 14: 20,793,931 D12A possibly damaging Het
Cgn T C 3: 94,779,990 M1V probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Dcbld1 C A 10: 52,284,257 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Espl1 T A 15: 102,312,518 L903Q probably damaging Het
Gm11639 T G 11: 104,753,806 probably null Het
Gm5117 T A 8: 31,737,882 noncoding transcript Het
Gm5150 T C 3: 15,963,424 T228A probably benign Het
Gm5435 A T 12: 82,496,476 noncoding transcript Het
Gpr156 T A 16: 38,005,448 C676S probably benign Het
Gstt3 C T 10: 75,774,851 E230K possibly damaging Het
Jarid2 A G 13: 44,906,271 I660V possibly damaging Het
Kif13a A G 13: 46,775,401 probably null Het
Kntc1 T A 5: 123,764,191 V299D probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipk T A 19: 34,020,213 probably null Het
Loxhd1 T C 18: 77,332,682 L334P probably damaging Het
Macc1 T A 12: 119,446,477 Y327N probably damaging Het
Man2a2 G A 7: 80,361,128 S705L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Ncam2 A T 16: 81,434,819 Q57L probably damaging Het
Nedd1 T C 10: 92,686,240 E645G probably damaging Het
Nfatc1 A T 18: 80,708,117 M1K probably null Het
Nlrp9b A T 7: 20,023,991 R384S probably damaging Het
Nrxn3 A G 12: 89,813,584 H62R possibly damaging Het
Olfr1097 A G 2: 86,890,620 L185S probably damaging Het
Olfr1233 T A 2: 89,339,459 Y281F probably damaging Het
Olfr640 T C 7: 104,021,997 H107R probably damaging Het
Olfr753-ps1 T A 17: 37,170,000 Y216F probably damaging Het
Olfr887 A T 9: 38,085,126 M97L probably benign Het
Pdzph1 T A 17: 58,974,880 I136F probably damaging Het
Pigg T C 5: 108,314,160 I119T probably damaging Het
Sept14 C T 5: 129,685,914 probably null Het
Slc9a3 T C 13: 74,150,960 M166T possibly damaging Het
Spock3 A G 8: 63,345,782 D279G probably damaging Het
Suco T C 1: 161,833,430 I967V probably damaging Het
Tgtp1 A G 11: 48,987,176 L234P probably damaging Het
Tmem176a A G 6: 48,842,217 D4G probably benign Het
Tmem2 T C 19: 21,798,329 I312T probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Uox A G 3: 146,624,545 D152G probably damaging Het
Vmn1r35 C T 6: 66,679,506 W60* probably null Het
Vmn2r103 T C 17: 19,812,171 C736R probably damaging Het
Other mutations in R3hdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:R3hdm2 APN 10 127458850 missense probably damaging 1.00
IGL02114:R3hdm2 APN 10 127484109 missense probably damaging 0.99
IGL02116:R3hdm2 APN 10 127498552 missense probably damaging 1.00
IGL02549:R3hdm2 APN 10 127484225 splice site probably benign
IGL02647:R3hdm2 APN 10 127459484 missense probably damaging 1.00
IGL02696:R3hdm2 APN 10 127465019 splice site probably null
IGL02732:R3hdm2 APN 10 127484060 missense probably benign 0.43
R0131:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0131:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0132:R3hdm2 UTSW 10 127498453 missense probably damaging 1.00
R0157:R3hdm2 UTSW 10 127471989 missense probably damaging 0.99
R0179:R3hdm2 UTSW 10 127495106 missense probably damaging 1.00
R0196:R3hdm2 UTSW 10 127484521 missense probably damaging 1.00
R0401:R3hdm2 UTSW 10 127458173 missense possibly damaging 0.90
R0505:R3hdm2 UTSW 10 127457700 missense probably damaging 1.00
R0606:R3hdm2 UTSW 10 127444444 missense probably damaging 1.00
R1188:R3hdm2 UTSW 10 127452755 missense probably benign 0.02
R1466:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1466:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1503:R3hdm2 UTSW 10 127471826 nonsense probably null
R1584:R3hdm2 UTSW 10 127476690 missense probably benign 0.01
R1652:R3hdm2 UTSW 10 127495091 missense probably benign 0.00
R1901:R3hdm2 UTSW 10 127498468 missense possibly damaging 0.91
R3735:R3hdm2 UTSW 10 127465010 missense probably benign
R5261:R3hdm2 UTSW 10 127498416 missense probably damaging 1.00
R5379:R3hdm2 UTSW 10 127471902 missense probably damaging 1.00
R5380:R3hdm2 UTSW 10 127485447 missense probably damaging 1.00
R5387:R3hdm2 UTSW 10 127485434 missense probably damaging 1.00
R5558:R3hdm2 UTSW 10 127444402 missense probably damaging 1.00
R5773:R3hdm2 UTSW 10 127444303 utr 5 prime probably benign
R5936:R3hdm2 UTSW 10 127471812 missense probably damaging 1.00
R6024:R3hdm2 UTSW 10 127459480 missense probably damaging 1.00
R6160:R3hdm2 UTSW 10 127484507 missense probably damaging 1.00
R6191:R3hdm2 UTSW 10 127484515 missense probably damaging 1.00
R7058:R3hdm2 UTSW 10 127484513 missense probably damaging 1.00
R7224:R3hdm2 UTSW 10 127458153 missense probably damaging 1.00
R7253:R3hdm2 UTSW 10 127481775 missense probably damaging 1.00
R7305:R3hdm2 UTSW 10 127476678 missense probably benign 0.08
R7349:R3hdm2 UTSW 10 127492646 missense probably benign
R7431:R3hdm2 UTSW 10 127458147 missense probably benign 0.16
R7891:R3hdm2 UTSW 10 127498574 missense probably benign 0.07
R7974:R3hdm2 UTSW 10 127498574 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTTAGGTAGCACCACGCAATG -3'
(R):5'- TCTCACAGAAGTAGGAATTGATGAG -3'

Sequencing Primer
(F):5'- GGCTGGAACACATTCATGTAC -3'
(R):5'- GTAGGAATTGATGAGATACCCTCCC -3'
Posted On2016-08-04