Mutagenetix > Incidental Mutations

Incidental Mutation 'R5329:Nrxn3'

422235

Institutional Source

Beutler Lab

Gene Symbol

Nrxn3

Ensembl Gene

ENSMUSG00000066392

Gene Name

neurexin III

Synonyms

4933401A11Rik, 9330112C09Rik, D12Bwg0831e, neurexin III alpha, neurexin III beta, neurexin III alpha, neurexin III beta

MMRRC Submission

042911-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5329 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88722876-90334935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89813584 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 62 (H62R)

Ref Sequence

ENSEMBL: ENSMUSP00000105760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057634] [ENSMUST00000110130] [ENSMUST00000110133] [ENSMUST00000163134] [ENSMUST00000167103] [ENSMUST00000167887] [ENSMUST00000190626]

Predicted Effect

probably benign
Transcript: ENSMUST00000057634

SMART Domains

Protein: ENSMUSP00000050075
Gene: ENSMUSG00000066392

Domain	Start	End	E-Value	Type
LamG	94	246	3.28e-41	SMART
EGF	273	307	4.1e-2	SMART
LamG	332	470	4.87e-26	SMART
LamG	518	654	7.08e-37	SMART
EGF	688	722	1.99e1	SMART
LamG	750	907	1.14e-17	SMART
low complexity region	948	964	N/A	INTRINSIC
low complexity region	1028	1043	N/A	INTRINSIC
4.1m	1046	1064	4.38e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110130
AA Change: H62R

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000105757
Gene: ENSMUSG00000066392
AA Change: H62R

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
LamG	107	264	1.14e-17	SMART
Blast:LamG	294	410	6e-47	BLAST
low complexity region	492	507	N/A	INTRINSIC
4.1m	510	528	4.38e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110133
AA Change: H62R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105760
Gene: ENSMUSG00000066392
AA Change: H62R

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
LamG	107	234	1.8e-20	SMART
Blast:LamG	264	330	1e-19	BLAST
low complexity region	358	373	N/A	INTRINSIC
4.1m	376	394	4.38e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163134

SMART Domains

Protein: ENSMUSP00000129678
Gene: ENSMUSG00000066392

Domain	Start	End	E-Value	Type
LamG	47	184	9.8e-31	SMART
EGF	201	235	8.07e-1	SMART
LamG	279	413	7.19e-38	SMART
LamG	467	619	3.28e-41	SMART
EGF	646	680	4.1e-2	SMART
LamG	705	843	4.87e-26	SMART
LamG	891	1027	7.08e-37	SMART
EGF	1052	1086	1.99e1	SMART
LamG	1114	1271	1.14e-17	SMART
low complexity region	1312	1328	N/A	INTRINSIC
low complexity region	1395	1406	N/A	INTRINSIC
low complexity region	1499	1514	N/A	INTRINSIC
4.1m	1517	1535	4.38e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167103

SMART Domains

Protein: ENSMUSP00000127407
Gene: ENSMUSG00000066392

Domain	Start	End	E-Value	Type
LamG	47	184	9.8e-31	SMART
EGF	201	235	8.07e-1	SMART
LamG	279	413	7.19e-38	SMART
LamG	467	619	3.28e-41	SMART
EGF	646	680	4.1e-2	SMART
LamG	705	834	5.76e-28	SMART
LamG	882	1018	7.08e-37	SMART
EGF	1043	1077	1.99e1	SMART
LamG	1105	1262	1.14e-17	SMART
low complexity region	1303	1319	N/A	INTRINSIC
low complexity region	1354	1382	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167887

SMART Domains

Protein: ENSMUSP00000127926
Gene: ENSMUSG00000066392

Domain	Start	End	E-Value	Type
LamG	94	246	3.28e-41	SMART
EGF	273	307	4.1e-2	SMART
LamG	332	470	4.87e-26	SMART
LamG	518	654	7.08e-37	SMART
EGF	688	722	1.99e1	SMART
LamG	750	907	1.14e-17	SMART
low complexity region	948	964	N/A	INTRINSIC
low complexity region	1028	1043	N/A	INTRINSIC
4.1m	1046	1064	4.38e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190626

SMART Domains

Protein: ENSMUSP00000139879
Gene: ENSMUSG00000066392

Domain	Start	End	E-Value	Type
LamG	94	246	2.1e-43	SMART
EGF	273	307	2e-4	SMART
LamG	332	470	3.1e-28	SMART
LamG	518	654	4.4e-39	SMART
EGF	688	722	9.6e-2	SMART
LamG	750	877	1.1e-22	SMART
low complexity region	918	934	N/A	INTRINSIC
low complexity region	972	1000	N/A	INTRINSIC

Meta Mutation Damage Score

0.1227

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. [provided by RefSeq, Dec 2012]
PHENOTYPE: Twenty percent of mice homozygous for a knock-out allele die postnatally prior to 20 days of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430005L14Rik	G	A	4: 153,959,827	V32I	probably benign	Het
Abcg4	A	T	9: 44,279,545	M19K	probably benign	Het
Acsm1	A	G	7: 119,656,051	T392A	probably benign	Het
Adam19	A	T	11: 46,125,026	I338F	probably damaging	Het
Adamdec1	C	T	14: 68,570,163	M349I	probably damaging	Het
Arhgef11	T	A	3: 87,679,752		probably benign	Het
Bptf	T	C	11: 107,073,295	D1628G	probably benign	Het
Camk2d	C	T	3: 126,597,482	Q15*	probably null	Het
Camk2g	T	G	14: 20,793,931	D12A	possibly damaging	Het
Cgn	T	C	3: 94,779,990	M1V	probably null	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Dcbld1	C	A	10: 52,284,257		probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Espl1	T	A	15: 102,312,518	L903Q	probably damaging	Het
Gm11639	T	G	11: 104,753,806		probably null	Het
Gm5117	T	A	8: 31,737,882		noncoding transcript	Het
Gm5150	T	C	3: 15,963,424	T228A	probably benign	Het
Gm5435	A	T	12: 82,496,476		noncoding transcript	Het
Gpr156	T	A	16: 38,005,448	C676S	probably benign	Het
Gstt3	C	T	10: 75,774,851	E230K	possibly damaging	Het
Jarid2	A	G	13: 44,906,271	I660V	possibly damaging	Het
Kif13a	A	G	13: 46,775,401		probably null	Het
Kntc1	T	A	5: 123,764,191	V299D	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lipk	T	A	19: 34,020,213		probably null	Het
Loxhd1	T	C	18: 77,332,682	L334P	probably damaging	Het
Macc1	T	A	12: 119,446,477	Y327N	probably damaging	Het
Man2a2	G	A	7: 80,361,128	S705L	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Ncam2	A	T	16: 81,434,819	Q57L	probably damaging	Het
Nedd1	T	C	10: 92,686,240	E645G	probably damaging	Het
Nfatc1	A	T	18: 80,708,117	M1K	probably null	Het
Nlrp9b	A	T	7: 20,023,991	R384S	probably damaging	Het
Olfr1097	A	G	2: 86,890,620	L185S	probably damaging	Het
Olfr1233	T	A	2: 89,339,459	Y281F	probably damaging	Het
Olfr640	T	C	7: 104,021,997	H107R	probably damaging	Het
Olfr753-ps1	T	A	17: 37,170,000	Y216F	probably damaging	Het
Olfr887	A	T	9: 38,085,126	M97L	probably benign	Het
Pdzph1	T	A	17: 58,974,880	I136F	probably damaging	Het
Pigg	T	C	5: 108,314,160	I119T	probably damaging	Het
R3hdm2	A	G	10: 127,458,893	H215R	probably damaging	Het
Sept14	C	T	5: 129,685,914		probably null	Het
Slc9a3	T	C	13: 74,150,960	M166T	possibly damaging	Het
Spock3	A	G	8: 63,345,782	D279G	probably damaging	Het
Suco	T	C	1: 161,833,430	I967V	probably damaging	Het
Tgtp1	A	G	11: 48,987,176	L234P	probably damaging	Het
Tmem176a	A	G	6: 48,842,217	D4G	probably benign	Het
Tmem2	T	C	19: 21,798,329	I312T	probably benign	Het
Ugt1a10	G	A	1: 88,216,254	A199T	probably damaging	Het
Uox	A	G	3: 146,624,545	D152G	probably damaging	Het
Vmn1r35	C	T	6: 66,679,506	W60*	probably null	Het
Vmn2r103	T	C	17: 19,812,171	C736R	probably damaging	Het

Other mutations in Nrxn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Nrxn3	APN	12	90204592	missense	probably damaging	1.00
IGL00961:Nrxn3	APN	12	90204546	missense	possibly damaging	0.95
IGL01073:Nrxn3	APN	12	89254740	missense	probably benign	0.25
IGL01338:Nrxn3	APN	12	89255034	missense	possibly damaging	0.86
IGL01377:Nrxn3	APN	12	89533012	critical splice donor site	probably null
IGL01409:Nrxn3	APN	12	89510358	missense	probably damaging	1.00
IGL01764:Nrxn3	APN	12	90204750	missense	possibly damaging	0.48
IGL02063:Nrxn3	APN	12	88795795	missense	possibly damaging	0.86
IGL02171:Nrxn3	APN	12	89193163	missense	probably damaging	1.00
IGL02309:Nrxn3	APN	12	89976407	missense	probably damaging	0.99
IGL02340:Nrxn3	APN	12	90204628	missense	possibly damaging	0.82
IGL02343:Nrxn3	APN	12	88795353	missense	probably damaging	1.00
IGL02600:Nrxn3	APN	12	89511912	splice site	probably benign
IGL02735:Nrxn3	APN	12	89254854	missense	probably benign	0.16
IGL03061:Nrxn3	APN	12	89511928	nonsense	probably null
IGL03206:Nrxn3	APN	12	89260508	missense	possibly damaging	0.88
IGL03337:Nrxn3	APN	12	89255020	missense	probably damaging	1.00
R0098:Nrxn3	UTSW	12	89260201	missense	probably damaging	1.00
R0098:Nrxn3	UTSW	12	89260201	missense	probably damaging	1.00
R0144:Nrxn3	UTSW	12	89348392	missense	probably damaging	1.00
R0334:Nrxn3	UTSW	12	89813642	critical splice donor site	probably null
R0531:Nrxn3	UTSW	12	88795342	missense	probably damaging	1.00
R0840:Nrxn3	UTSW	12	90331793	missense	possibly damaging	0.68
R1324:Nrxn3	UTSW	12	89254696	missense	possibly damaging	0.89
R1438:Nrxn3	UTSW	12	90332135	missense	probably damaging	1.00
R1484:Nrxn3	UTSW	12	89254777	missense	probably damaging	0.99
R1621:Nrxn3	UTSW	12	88795710	missense	probably benign
R1637:Nrxn3	UTSW	12	89354468	missense	possibly damaging	0.94
R1659:Nrxn3	UTSW	12	90332391	missense	probably damaging	1.00
R1746:Nrxn3	UTSW	12	89255019	missense	possibly damaging	0.63
R1801:Nrxn3	UTSW	12	90283582	missense	probably damaging	1.00
R1912:Nrxn3	UTSW	12	88795342	missense	probably damaging	1.00
R1940:Nrxn3	UTSW	12	89260381	missense	probably damaging	0.98
R1993:Nrxn3	UTSW	12	89260411	missense	possibly damaging	0.59
R2002:Nrxn3	UTSW	12	90332315	missense	probably damaging	1.00
R2125:Nrxn3	UTSW	12	89260520	splice site	probably null
R2179:Nrxn3	UTSW	12	89254678	missense	probably damaging	1.00
R2207:Nrxn3	UTSW	12	89348312	missense	probably damaging	1.00
R2284:Nrxn3	UTSW	12	89510365	missense	probably damaging	1.00
R2433:Nrxn3	UTSW	12	89976392	missense	probably damaging	1.00
R2969:Nrxn3	UTSW	12	89354471	missense	probably damaging	1.00
R3053:Nrxn3	UTSW	12	89255101	missense	probably damaging	0.99
R3076:Nrxn3	UTSW	12	89260416	missense	probably damaging	1.00
R3078:Nrxn3	UTSW	12	89260416	missense	probably damaging	1.00
R4033:Nrxn3	UTSW	12	89533001	missense	probably damaging	1.00
R4222:Nrxn3	UTSW	12	89532992	nonsense	probably null
R4321:Nrxn3	UTSW	12	90199231	missense	probably damaging	1.00
R4470:Nrxn3	UTSW	12	90204741	missense	probably damaging	1.00
R4471:Nrxn3	UTSW	12	90204741	missense	probably damaging	1.00
R4472:Nrxn3	UTSW	12	90204741	missense	probably damaging	1.00
R4686:Nrxn3	UTSW	12	89510651	missense	probably damaging	0.99
R4776:Nrxn3	UTSW	12	90331956	missense	possibly damaging	0.55
R4821:Nrxn3	UTSW	12	90204709	missense	probably damaging	0.99
R4869:Nrxn3	UTSW	12	88795582	missense	possibly damaging	0.95
R4910:Nrxn3	UTSW	12	89260360	missense	possibly damaging	0.72
R4960:Nrxn3	UTSW	12	88795201	missense	possibly damaging	0.79
R4990:Nrxn3	UTSW	12	89260474	missense	probably damaging	1.00
R4991:Nrxn3	UTSW	12	89260474	missense	probably damaging	1.00
R5057:Nrxn3	UTSW	12	89255034	missense	probably damaging	0.99
R5888:Nrxn3	UTSW	12	89512085	missense	possibly damaging	0.91
R6249:Nrxn3	UTSW	12	89254678	missense	probably damaging	1.00
R6264:Nrxn3	UTSW	12	90332237	missense	probably damaging	1.00
R6373:Nrxn3	UTSW	12	89976469	missense	probably damaging	1.00
R6401:Nrxn3	UTSW	12	89255000	missense	possibly damaging	0.46
R6434:Nrxn3	UTSW	12	88795515	missense	probably benign	0.32
R6528:Nrxn3	UTSW	12	89513049	missense	probably damaging	1.00
R6612:Nrxn3	UTSW	12	89813332	intron	probably benign
R6632:Nrxn3	UTSW	12	89193154	missense	probably damaging	1.00
R6874:Nrxn3	UTSW	12	90332190	missense	probably damaging	0.99
R7122:Nrxn3	UTSW	12	89510607	missense	probably damaging	1.00
R7328:Nrxn3	UTSW	12	88795575	missense	probably benign
R7352:Nrxn3	UTSW	12	88850293	missense	probably benign
R7425:Nrxn3	UTSW	12	89513100	nonsense	probably null
R7444:Nrxn3	UTSW	12	89510694	missense	probably damaging	1.00
R7483:Nrxn3	UTSW	12	89510462	missense	probably damaging	1.00
R7599:Nrxn3	UTSW	12	89512062	missense	probably benign
R7738:Nrxn3	UTSW	12	88850304	missense	possibly damaging	0.68
R7765:Nrxn3	UTSW	12	89813484	missense	probably benign	0.03
X0019:Nrxn3	UTSW	12	90199221	missense	probably damaging	1.00
Z1176:Nrxn3	UTSW	12	89187055	nonsense	probably null
Z1176:Nrxn3	UTSW	12	89517909	missense	not run
Z1177:Nrxn3	UTSW	12	88795688	missense	not run
Z1177:Nrxn3	UTSW	12	89260312	missense	not run
Z1177:Nrxn3	UTSW	12	90331845	missense	not run
Z1177:Nrxn3	UTSW	12	90332114	missense	not run

Predicted Primers

PCR Primer
(F):5'- TAGTGGTCCAGTGCGTTGAC -3'
(R):5'- GACAATTTTCCCCTTATGCACATGC -3'

Sequencing Primer
(F):5'- GTTGACCATGCACCTGAGAATC -3'
(R):5'- CCTGAAAGACAGTGGGTT -3'

Posted On

2016-08-04