Mutagenetix > Incidental Mutations

Incidental Mutation 'R5329:Kif13a'

422238

Institutional Source

Beutler Lab

Gene Symbol

Kif13a

Ensembl Gene

ENSMUSG00000021375

Gene Name

kinesin family member 13A

Synonyms

4930505I07Rik, N-3 kinesin

MMRRC Submission

042911-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.425) question?

Stock #

R5329 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46749087-46929867 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 46775401 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000223881] [ENSMUST00000225591]

Predicted Effect

probably null
Transcript: ENSMUST00000056978

SMART Domains

Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375

Domain	Start	End	E-Value	Type
KISc	3	360	2.69e-175	SMART
low complexity region	368	381	N/A	INTRINSIC
low complexity region	391	406	N/A	INTRINSIC
FHA	469	519	7.16e-2	SMART
coiled coil region	605	639	N/A	INTRINSIC
coiled coil region	664	704	N/A	INTRINSIC
Pfam:KIF1B	748	792	1.7e-19	PFAM
low complexity region	840	854	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
Pfam:DUF3694	1003	1270	2.2e-39	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1475	1492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223856

Predicted Effect

probably null
Transcript: ENSMUST00000223881

Predicted Effect

probably benign
Transcript: ENSMUST00000224756

Predicted Effect

probably benign
Transcript: ENSMUST00000225591

Meta Mutation Damage Score

0.9487

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430005L14Rik	G	A	4: 153,959,827	V32I	probably benign	Het
Abcg4	A	T	9: 44,279,545	M19K	probably benign	Het
Acsm1	A	G	7: 119,656,051	T392A	probably benign	Het
Adam19	A	T	11: 46,125,026	I338F	probably damaging	Het
Adamdec1	C	T	14: 68,570,163	M349I	probably damaging	Het
Arhgef11	T	A	3: 87,679,752		probably benign	Het
Bptf	T	C	11: 107,073,295	D1628G	probably benign	Het
Camk2d	C	T	3: 126,597,482	Q15*	probably null	Het
Camk2g	T	G	14: 20,793,931	D12A	possibly damaging	Het
Cgn	T	C	3: 94,779,990	M1V	probably null	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Dcbld1	C	A	10: 52,284,257		probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Espl1	T	A	15: 102,312,518	L903Q	probably damaging	Het
Gm11639	T	G	11: 104,753,806		probably null	Het
Gm5117	T	A	8: 31,737,882		noncoding transcript	Het
Gm5150	T	C	3: 15,963,424	T228A	probably benign	Het
Gm5435	A	T	12: 82,496,476		noncoding transcript	Het
Gpr156	T	A	16: 38,005,448	C676S	probably benign	Het
Gstt3	C	T	10: 75,774,851	E230K	possibly damaging	Het
Jarid2	A	G	13: 44,906,271	I660V	possibly damaging	Het
Kntc1	T	A	5: 123,764,191	V299D	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lipk	T	A	19: 34,020,213		probably null	Het
Loxhd1	T	C	18: 77,332,682	L334P	probably damaging	Het
Macc1	T	A	12: 119,446,477	Y327N	probably damaging	Het
Man2a2	G	A	7: 80,361,128	S705L	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Ncam2	A	T	16: 81,434,819	Q57L	probably damaging	Het
Nedd1	T	C	10: 92,686,240	E645G	probably damaging	Het
Nfatc1	A	T	18: 80,708,117	M1K	probably null	Het
Nlrp9b	A	T	7: 20,023,991	R384S	probably damaging	Het
Nrxn3	A	G	12: 89,813,584	H62R	possibly damaging	Het
Olfr1097	A	G	2: 86,890,620	L185S	probably damaging	Het
Olfr1233	T	A	2: 89,339,459	Y281F	probably damaging	Het
Olfr640	T	C	7: 104,021,997	H107R	probably damaging	Het
Olfr753-ps1	T	A	17: 37,170,000	Y216F	probably damaging	Het
Olfr887	A	T	9: 38,085,126	M97L	probably benign	Het
Pdzph1	T	A	17: 58,974,880	I136F	probably damaging	Het
Pigg	T	C	5: 108,314,160	I119T	probably damaging	Het
R3hdm2	A	G	10: 127,458,893	H215R	probably damaging	Het
Sept14	C	T	5: 129,685,914		probably null	Het
Slc9a3	T	C	13: 74,150,960	M166T	possibly damaging	Het
Spock3	A	G	8: 63,345,782	D279G	probably damaging	Het
Suco	T	C	1: 161,833,430	I967V	probably damaging	Het
Tgtp1	A	G	11: 48,987,176	L234P	probably damaging	Het
Tmem176a	A	G	6: 48,842,217	D4G	probably benign	Het
Tmem2	T	C	19: 21,798,329	I312T	probably benign	Het
Ugt1a10	G	A	1: 88,216,254	A199T	probably damaging	Het
Uox	A	G	3: 146,624,545	D152G	probably damaging	Het
Vmn1r35	C	T	6: 66,679,506	W60*	probably null	Het
Vmn2r103	T	C	17: 19,812,171	C736R	probably damaging	Het

Other mutations in Kif13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Kif13a	APN	13	46750634	splice site	probably benign
IGL01433:Kif13a	APN	13	46772908	missense	probably damaging	1.00
IGL01528:Kif13a	APN	13	46864837	splice site	probably benign
IGL01536:Kif13a	APN	13	46752289	missense	probably damaging	0.96
IGL01620:Kif13a	APN	13	46864820	missense	probably benign
IGL02020:Kif13a	APN	13	46794019	missense	probably benign	0.05
IGL02142:Kif13a	APN	13	46771535	missense	probably benign	0.04
IGL02375:Kif13a	APN	13	46825222	missense	probably damaging	1.00
IGL02407:Kif13a	APN	13	46785293	missense	probably damaging	0.99
IGL02476:Kif13a	APN	13	46785296	missense	probably damaging	1.00
IGL03038:Kif13a	APN	13	46772838	missense	probably damaging	1.00
IGL03053:Kif13a	APN	13	46752088	missense	probably benign	0.01
IGL03366:Kif13a	APN	13	46764623	missense	probably benign	0.00
R0025:Kif13a	UTSW	13	46786511	critical splice donor site	probably null
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0135:Kif13a	UTSW	13	46793943	missense	probably damaging	0.99
R0137:Kif13a	UTSW	13	46764603	missense	probably benign	0.38
R0243:Kif13a	UTSW	13	46791351	missense	probably benign	0.24
R0346:Kif13a	UTSW	13	46814219	missense	possibly damaging	0.95
R0403:Kif13a	UTSW	13	46791401	missense	probably damaging	1.00
R0492:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0607:Kif13a	UTSW	13	46802711	missense	probably damaging	0.96
R0631:Kif13a	UTSW	13	46778888	unclassified	probably benign
R0654:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0697:Kif13a	UTSW	13	46848337	missense	probably benign	0.19
R0699:Kif13a	UTSW	13	46799213	missense	possibly damaging	0.92
R0715:Kif13a	UTSW	13	46812823	missense	probably damaging	0.98
R0834:Kif13a	UTSW	13	46814236	missense	probably damaging	0.96
R0903:Kif13a	UTSW	13	46929259	missense	possibly damaging	0.75
R1419:Kif13a	UTSW	13	46825235	missense	probably damaging	1.00
R1428:Kif13a	UTSW	13	46791511	splice site	probably benign
R1449:Kif13a	UTSW	13	46812736	missense	probably damaging	1.00
R1463:Kif13a	UTSW	13	46929612	missense	possibly damaging	0.75
R1541:Kif13a	UTSW	13	46809213	missense	probably benign
R1579:Kif13a	UTSW	13	46752856	missense	possibly damaging	0.93
R1582:Kif13a	UTSW	13	46793922	missense	probably benign	0.03
R1644:Kif13a	UTSW	13	46793922	missense	probably benign	0.31
R1752:Kif13a	UTSW	13	46798409	missense	probably damaging	1.00
R1755:Kif13a	UTSW	13	46752613	missense	possibly damaging	0.73
R1755:Kif13a	UTSW	13	46773678	missense	possibly damaging	0.50
R1858:Kif13a	UTSW	13	46864838	splice site	probably benign
R1891:Kif13a	UTSW	13	46929219	missense	possibly damaging	0.63
R1902:Kif13a	UTSW	13	46788162	missense	probably benign	0.00
R1928:Kif13a	UTSW	13	46812745	missense	probably damaging	1.00
R1960:Kif13a	UTSW	13	46864838	splice site	probably benign
R1961:Kif13a	UTSW	13	46864838	splice site	probably benign
R2016:Kif13a	UTSW	13	46810799	missense	probably benign	0.13
R2139:Kif13a	UTSW	13	46752469	missense	possibly damaging	0.92
R2174:Kif13a	UTSW	13	46769176	missense	probably damaging	0.99
R2407:Kif13a	UTSW	13	46777097	missense	probably damaging	1.00
R2504:Kif13a	UTSW	13	46814200	missense	probably damaging	1.00
R3122:Kif13a	UTSW	13	46764596	splice site	probably benign
R3499:Kif13a	UTSW	13	46825339	missense	probably damaging	1.00
R3905:Kif13a	UTSW	13	46802690	missense	probably damaging	1.00
R4474:Kif13a	UTSW	13	46814155	splice site	probably null
R4771:Kif13a	UTSW	13	46825211	missense	probably damaging	1.00
R4838:Kif13a	UTSW	13	46826748	missense	probably damaging	1.00
R4924:Kif13a	UTSW	13	46929599	missense	probably damaging	1.00
R4931:Kif13a	UTSW	13	46809055	missense	probably damaging	0.96
R4980:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R4992:Kif13a	UTSW	13	46777163	missense	probably damaging	0.96
R5047:Kif13a	UTSW	13	46788085	missense	probably benign	0.00
R5054:Kif13a	UTSW	13	46802646	missense	probably damaging	1.00
R5141:Kif13a	UTSW	13	46752721	missense	probably benign
R5429:Kif13a	UTSW	13	46772769	critical splice donor site	probably null
R5499:Kif13a	UTSW	13	46832736	missense	probably damaging	1.00
R5509:Kif13a	UTSW	13	46752115	missense	probably benign	0.13
R5594:Kif13a	UTSW	13	46752862	missense	probably damaging	1.00
R5921:Kif13a	UTSW	13	46825300	missense	probably damaging	1.00
R5964:Kif13a	UTSW	13	46771524	missense	probably damaging	1.00
R6115:Kif13a	UTSW	13	46801313	missense	probably damaging	1.00
R6317:Kif13a	UTSW	13	46826757	missense	probably damaging	1.00
R6318:Kif13a	UTSW	13	46815207	splice site	probably null
R6393:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6394:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6395:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6735:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R7037:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7038:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7039:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7237:Kif13a	UTSW	13	46809156	critical splice donor site	probably null
R7285:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7286:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7287:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7341:Kif13a	UTSW	13	46826745	missense	probably damaging	1.00
R7693:Kif13a	UTSW	13	46750613	missense	probably benign	0.01
R7761:Kif13a	UTSW	13	46798479	missense	probably benign
R8098:Kif13a	UTSW	13	46815304	missense	probably damaging	1.00
R8171:Kif13a	UTSW	13	46778968	missense	probably damaging	1.00
R8271:Kif13a	UTSW	13	46752581	missense	probably benign	0.01
X0013:Kif13a	UTSW	13	46929270	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- ATCTGTCCTCCAGTGACCAC -3'
(R):5'- CTCATTCTCACAGCAGAATCATGC -3'

Sequencing Primer
(F):5'- ACGGGCCATGCTGATACATG -3'
(R):5'- CACTGTAGGGCATCTCATCTAAGG -3'

Posted On

2016-08-04