Mutagenetix > Incidental Mutations

Incidental Mutation 'R5329:Camk2g'

422239

Institutional Source

Beutler Lab

Gene Symbol

Camk2g

Ensembl Gene

ENSMUSG00000021820

Gene Name

calcium/calmodulin-dependent protein kinase II gamma

Synonyms

CaMK II, 5930429P18Rik, Camkg, Ca2+/calmodulin-dependent protein kinase II

MMRRC Submission

042911-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5329 (G1)

Quality Score

201

Status

Validated

Chromosome

Chromosomal Location

20734875-20794088 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 20793931 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 12 (D12A)

Ref Sequence

ENSEMBL: ENSMUSP00000154158 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071816] [ENSMUST00000080440] [ENSMUST00000100837] [ENSMUST00000226630]

Predicted Effect

probably benign
Transcript: ENSMUST00000071816
AA Change: D12A

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000071720
Gene: ENSMUSG00000021820
AA Change: D12A

Domain	Start	End	E-Value	Type
S_TKc	14	272	6.15e-106	SMART
low complexity region	323	338	N/A	INTRINSIC
Pfam:CaMKII_AD	397	524	2.7e-62	PFAM
Pfam:DUF4440	401	514	3.9e-12	PFAM
Pfam:SnoaL_3	401	526	4.6e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000080440
AA Change: D12A

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000079298
Gene: ENSMUSG00000021820
AA Change: D12A

Domain	Start	End	E-Value	Type
S_TKc	14	272	6.15e-106	SMART
Pfam:CaMKII_AD	386	513	3.7e-63	PFAM
Pfam:DUF4440	390	504	3.2e-14	PFAM
Pfam:SnoaL_3	390	515	4.1e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000100837
AA Change: D12A

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000098398
Gene: ENSMUSG00000021820
AA Change: D12A

Domain	Start	End	E-Value	Type
S_TKc	14	272	6.15e-106	SMART
Pfam:CaMKII_AD	363	490	3.8e-63	PFAM
Pfam:DUF4440	367	481	3.6e-14	PFAM
Pfam:SnoaL_3	367	492	4.7e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224276

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224566

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224804

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225635

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225660

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225958

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226630
AA Change: D12A

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)

Meta Mutation Damage Score

0.1327

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is one of the four subunits of an enzyme which belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a gamma chain. Many alternatively spliced transcripts encoding different isoforms have been described but the full-length nature of all the variants has not been determined.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility and decreased sensitivity of macrophages to ER stress-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430005L14Rik	G	A	4: 153,959,827	V32I	probably benign	Het
Abcg4	A	T	9: 44,279,545	M19K	probably benign	Het
Acsm1	A	G	7: 119,656,051	T392A	probably benign	Het
Adam19	A	T	11: 46,125,026	I338F	probably damaging	Het
Adamdec1	C	T	14: 68,570,163	M349I	probably damaging	Het
Arhgef11	T	A	3: 87,679,752		probably benign	Het
Bptf	T	C	11: 107,073,295	D1628G	probably benign	Het
Camk2d	C	T	3: 126,597,482	Q15*	probably null	Het
Cgn	T	C	3: 94,779,990	M1V	probably null	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Dcbld1	C	A	10: 52,284,257		probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Espl1	T	A	15: 102,312,518	L903Q	probably damaging	Het
Gm11639	T	G	11: 104,753,806		probably null	Het
Gm5117	T	A	8: 31,737,882		noncoding transcript	Het
Gm5150	T	C	3: 15,963,424	T228A	probably benign	Het
Gm5435	A	T	12: 82,496,476		noncoding transcript	Het
Gpr156	T	A	16: 38,005,448	C676S	probably benign	Het
Gstt3	C	T	10: 75,774,851	E230K	possibly damaging	Het
Jarid2	A	G	13: 44,906,271	I660V	possibly damaging	Het
Kif13a	A	G	13: 46,775,401		probably null	Het
Kntc1	T	A	5: 123,764,191	V299D	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lipk	T	A	19: 34,020,213		probably null	Het
Loxhd1	T	C	18: 77,332,682	L334P	probably damaging	Het
Macc1	T	A	12: 119,446,477	Y327N	probably damaging	Het
Man2a2	G	A	7: 80,361,128	S705L	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Ncam2	A	T	16: 81,434,819	Q57L	probably damaging	Het
Nedd1	T	C	10: 92,686,240	E645G	probably damaging	Het
Nfatc1	A	T	18: 80,708,117	M1K	probably null	Het
Nlrp9b	A	T	7: 20,023,991	R384S	probably damaging	Het
Nrxn3	A	G	12: 89,813,584	H62R	possibly damaging	Het
Olfr1097	A	G	2: 86,890,620	L185S	probably damaging	Het
Olfr1233	T	A	2: 89,339,459	Y281F	probably damaging	Het
Olfr640	T	C	7: 104,021,997	H107R	probably damaging	Het
Olfr753-ps1	T	A	17: 37,170,000	Y216F	probably damaging	Het
Olfr887	A	T	9: 38,085,126	M97L	probably benign	Het
Pdzph1	T	A	17: 58,974,880	I136F	probably damaging	Het
Pigg	T	C	5: 108,314,160	I119T	probably damaging	Het
R3hdm2	A	G	10: 127,458,893	H215R	probably damaging	Het
Sept14	C	T	5: 129,685,914		probably null	Het
Slc9a3	T	C	13: 74,150,960	M166T	possibly damaging	Het
Spock3	A	G	8: 63,345,782	D279G	probably damaging	Het
Suco	T	C	1: 161,833,430	I967V	probably damaging	Het
Tgtp1	A	G	11: 48,987,176	L234P	probably damaging	Het
Tmem176a	A	G	6: 48,842,217	D4G	probably benign	Het
Tmem2	T	C	19: 21,798,329	I312T	probably benign	Het
Ugt1a10	G	A	1: 88,216,254	A199T	probably damaging	Het
Uox	A	G	3: 146,624,545	D152G	probably damaging	Het
Vmn1r35	C	T	6: 66,679,506	W60*	probably null	Het
Vmn2r103	T	C	17: 19,812,171	C736R	probably damaging	Het

Other mutations in Camk2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL00822:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL00932:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL00934:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL00935:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL00938:Camk2g	APN	14	20737330	missense	probably damaging	0.99
IGL01151:Camk2g	APN	14	20765959	missense	probably damaging	1.00
IGL01578:Camk2g	APN	14	20747854	splice site	probably benign
IGL02749:Camk2g	APN	14	20766016	critical splice acceptor site	probably null
changchun	UTSW	14	20742708	nonsense	probably null
Jilin	UTSW	14	20766212	nonsense	probably null
jingyuetan	UTSW	14	20793931	missense	possibly damaging	0.57
Manchuria	UTSW	14	20764949	missense	probably damaging	1.00
F5770:Camk2g	UTSW	14	20739312	splice site	probably benign
R0047:Camk2g	UTSW	14	20771068	splice site	probably benign
R0761:Camk2g	UTSW	14	20766212	nonsense	probably null
R0783:Camk2g	UTSW	14	20744636	missense	possibly damaging	0.56
R2239:Camk2g	UTSW	14	20739387	missense	probably damaging	1.00
R2240:Camk2g	UTSW	14	20765446	missense	probably damaging	1.00
R2380:Camk2g	UTSW	14	20739387	missense	probably damaging	1.00
R3623:Camk2g	UTSW	14	20755707	splice site	probably benign
R3842:Camk2g	UTSW	14	20764898	missense	probably damaging	0.99
R4909:Camk2g	UTSW	14	20792584	missense	probably benign	0.29
R5613:Camk2g	UTSW	14	20737491	missense	probably damaging	0.98
R5763:Camk2g	UTSW	14	20739347	missense	probably damaging	1.00
R6294:Camk2g	UTSW	14	20764949	missense	probably damaging	1.00
R6345:Camk2g	UTSW	14	20737375	missense	probably damaging	1.00
R6698:Camk2g	UTSW	14	20742708	nonsense	probably null
R7010:Camk2g	UTSW	14	20741444	missense	probably benign
R7187:Camk2g	UTSW	14	20742712	missense	probably benign
R7257:Camk2g	UTSW	14	20747839	missense	probably benign	0.01
R7459:Camk2g	UTSW	14	20779207	missense	probably damaging	0.97
R7655:Camk2g	UTSW	14	20739342	missense	possibly damaging	0.69
R7656:Camk2g	UTSW	14	20739342	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- CAGCACGCGGGAAAAGCT -3'
(R):5'- GGTGTCTTCCAGTTCGGTCG -3'

Sequencing Primer
(F):5'- AAAGCTGGGGGTGGGGC -3'
(R):5'- AGTTCGGTCGGTCCCAGTG -3'

Posted On

2016-08-04