Mutagenetix > Incidental Mutations

Incidental Mutation 'R5329:Adamdec1'

422241

Institutional Source

Beutler Lab

Gene Symbol

Adamdec1

Ensembl Gene

ENSMUSG00000022057

Gene Name

ADAM-like, decysin 1

Synonyms

2210414L24Rik, Dcsn

MMRRC Submission

042911-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R5329 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68563380-68582095 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 68570163 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 349 (M349I)

Ref Sequence

ENSEMBL: ENSMUSP00000022641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022641]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022641
AA Change: M349I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022641
Gene: ENSMUSG00000022057
AA Change: M349I

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Pep_M12B_propep	37	175	3.9e-29	PFAM
Pfam:Reprolysin_5	215	389	9.8e-17	PFAM
Pfam:Reprolysin_4	216	407	7.3e-12	PFAM
Pfam:Reprolysin	217	411	1.5e-57	PFAM
Pfam:Reprolysin_3	242	360	1e-11	PFAM
DISIN	427	465	1.12e-3	SMART

Meta Mutation Damage Score

0.3253

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This encoded protein is thought to be a secreted protein belonging to the disintegrin metalloproteinase family. Its expression is upregulated during dendritic cells maturation. This protein may play an important role in dendritic cell function and their interactions with germinal center T cells. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430005L14Rik	G	A	4: 153,959,827	V32I	probably benign	Het
Abcg4	A	T	9: 44,279,545	M19K	probably benign	Het
Acsm1	A	G	7: 119,656,051	T392A	probably benign	Het
Adam19	A	T	11: 46,125,026	I338F	probably damaging	Het
Arhgef11	T	A	3: 87,679,752		probably benign	Het
Bptf	T	C	11: 107,073,295	D1628G	probably benign	Het
Camk2d	C	T	3: 126,597,482	Q15*	probably null	Het
Camk2g	T	G	14: 20,793,931	D12A	possibly damaging	Het
Cgn	T	C	3: 94,779,990	M1V	probably null	Het
Clec16a	G	A	16: 10,731,679	C872Y	probably damaging	Het
Dcbld1	C	A	10: 52,284,257		probably benign	Het
Ear-ps2	G	A	14: 44,047,060		noncoding transcript	Het
Espl1	T	A	15: 102,312,518	L903Q	probably damaging	Het
Gm11639	T	G	11: 104,753,806		probably null	Het
Gm5117	T	A	8: 31,737,882		noncoding transcript	Het
Gm5150	T	C	3: 15,963,424	T228A	probably benign	Het
Gm5435	A	T	12: 82,496,476		noncoding transcript	Het
Gpr156	T	A	16: 38,005,448	C676S	probably benign	Het
Gstt3	C	T	10: 75,774,851	E230K	possibly damaging	Het
Jarid2	A	G	13: 44,906,271	I660V	possibly damaging	Het
Kif13a	A	G	13: 46,775,401		probably null	Het
Kntc1	T	A	5: 123,764,191	V299D	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lipk	T	A	19: 34,020,213		probably null	Het
Loxhd1	T	C	18: 77,332,682	L334P	probably damaging	Het
Macc1	T	A	12: 119,446,477	Y327N	probably damaging	Het
Man2a2	G	A	7: 80,361,128	S705L	possibly damaging	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Ncam2	A	T	16: 81,434,819	Q57L	probably damaging	Het
Nedd1	T	C	10: 92,686,240	E645G	probably damaging	Het
Nfatc1	A	T	18: 80,708,117	M1K	probably null	Het
Nlrp9b	A	T	7: 20,023,991	R384S	probably damaging	Het
Nrxn3	A	G	12: 89,813,584	H62R	possibly damaging	Het
Olfr1097	A	G	2: 86,890,620	L185S	probably damaging	Het
Olfr1233	T	A	2: 89,339,459	Y281F	probably damaging	Het
Olfr640	T	C	7: 104,021,997	H107R	probably damaging	Het
Olfr753-ps1	T	A	17: 37,170,000	Y216F	probably damaging	Het
Olfr887	A	T	9: 38,085,126	M97L	probably benign	Het
Pdzph1	T	A	17: 58,974,880	I136F	probably damaging	Het
Pigg	T	C	5: 108,314,160	I119T	probably damaging	Het
R3hdm2	A	G	10: 127,458,893	H215R	probably damaging	Het
Sept14	C	T	5: 129,685,914		probably null	Het
Slc9a3	T	C	13: 74,150,960	M166T	possibly damaging	Het
Spock3	A	G	8: 63,345,782	D279G	probably damaging	Het
Suco	T	C	1: 161,833,430	I967V	probably damaging	Het
Tgtp1	A	G	11: 48,987,176	L234P	probably damaging	Het
Tmem176a	A	G	6: 48,842,217	D4G	probably benign	Het
Tmem2	T	C	19: 21,798,329	I312T	probably benign	Het
Ugt1a10	G	A	1: 88,216,254	A199T	probably damaging	Het
Uox	A	G	3: 146,624,545	D152G	probably damaging	Het
Vmn1r35	C	T	6: 66,679,506	W60*	probably null	Het
Vmn2r103	T	C	17: 19,812,171	C736R	probably damaging	Het

Other mutations in Adamdec1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01691:Adamdec1	APN	14	68573107	missense	probably damaging	1.00
IGL02026:Adamdec1	APN	14	68571802	missense	possibly damaging	0.81
IGL02068:Adamdec1	APN	14	68577109	missense	probably benign	0.21
IGL02416:Adamdec1	APN	14	68572833	missense	probably null	0.99
IGL02739:Adamdec1	APN	14	68570156	nonsense	probably null
IGL03078:Adamdec1	APN	14	68568850	missense	possibly damaging	0.53
IGL03115:Adamdec1	APN	14	68571353	missense	probably damaging	1.00
R0201:Adamdec1	UTSW	14	68581957	critical splice donor site	probably null
R0243:Adamdec1	UTSW	14	68581958	critical splice donor site	probably null
R0244:Adamdec1	UTSW	14	68568723	nonsense	probably null
R0416:Adamdec1	UTSW	14	68568712	missense	possibly damaging	0.79
R1373:Adamdec1	UTSW	14	68570951	missense	probably damaging	1.00
R1856:Adamdec1	UTSW	14	68570948	missense	probably damaging	1.00
R2570:Adamdec1	UTSW	14	68579208	missense	probably damaging	0.98
R3684:Adamdec1	UTSW	14	68581998	missense	probably benign	0.04
R3755:Adamdec1	UTSW	14	68577138	missense	probably damaging	1.00
R4450:Adamdec1	UTSW	14	68573119	missense	probably benign	0.00
R4661:Adamdec1	UTSW	14	68570113	missense	probably damaging	1.00
R4672:Adamdec1	UTSW	14	68577904	nonsense	probably null
R4673:Adamdec1	UTSW	14	68577904	nonsense	probably null
R4902:Adamdec1	UTSW	14	68571766	missense	probably damaging	0.99
R5017:Adamdec1	UTSW	14	68573245	missense	probably benign	0.01
R5018:Adamdec1	UTSW	14	68571779	missense	probably damaging	1.00
R5141:Adamdec1	UTSW	14	68573128	missense	probably benign	0.00
R5395:Adamdec1	UTSW	14	68570903	missense	probably benign	0.04
R5864:Adamdec1	UTSW	14	68570102	missense	probably damaging	1.00
R6032:Adamdec1	UTSW	14	68579184	missense	probably damaging	1.00
R6032:Adamdec1	UTSW	14	68579184	missense	probably damaging	1.00
R6114:Adamdec1	UTSW	14	68571803	missense	probably benign	0.00
R6633:Adamdec1	UTSW	14	68573152	missense	probably benign	0.03
R7243:Adamdec1	UTSW	14	68571754	missense	probably benign	0.06
R7580:Adamdec1	UTSW	14	68565531	missense	probably benign	0.00
R8388:Adamdec1	UTSW	14	68573235	nonsense	probably null
X0025:Adamdec1	UTSW	14	68570158	missense	probably damaging	1.00
X0050:Adamdec1	UTSW	14	68570158	missense	probably damaging	1.00
X0062:Adamdec1	UTSW	14	68573252	missense	probably benign	0.12
Z1177:Adamdec1	UTSW	14	68580643	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGCATGAGTCTTGAATTTGGC -3'
(R):5'- TAGGAGCCAGTCATACCAGG -3'

Sequencing Primer
(F):5'- CATGAGTCTTGAATTTGGCAAAATAC -3'
(R):5'- ATGATTTGAGAAGACCTGAG -3'

Posted On

2016-08-04