Incidental Mutation 'R5329:Clec16a'
ID422243
Institutional Source Beutler Lab
Gene Symbol Clec16a
Ensembl Gene ENSMUSG00000068663
Gene NameC-type lectin domain family 16, member A
Synonyms4932416N17Rik, curt
MMRRC Submission 042911-MU
Accession Numbers

NCBI RefSeq: NM_177562.5, NM_001204229.1; MGI: 1921624

Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R5329 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location10545339-10744878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10731679 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 872 (C872Y)
Ref Sequence ENSEMBL: ENSMUSP00000111490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066345] [ENSMUST00000115823] [ENSMUST00000115824] [ENSMUST00000115828] [ENSMUST00000155633]
Predicted Effect probably damaging
Transcript: ENSMUST00000066345
AA Change: C872Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663
AA Change: C872Y

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115823
AA Change: C451Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111489
Gene: ENSMUSG00000068663
AA Change: C451Y

DomainStartEndE-ValueType
low complexity region 456 491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115824
AA Change: C872Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663
AA Change: C872Y

DomainStartEndE-ValueType
Pfam:FPL 51 198 5.9e-66 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115828
SMART Domains Protein: ENSMUSP00000111494
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 2.1e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155633
AA Change: C870Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123189
Gene: ENSMUSG00000068663
AA Change: C870Y

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 396 417 N/A INTRINSIC
low complexity region 875 922 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
Meta Mutation Damage Score 0.1215 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation have a curved tail, small body size, squinting eyes, crooked digits that curve outward, and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik G A 4: 153,959,827 V32I probably benign Het
Abcg4 A T 9: 44,279,545 M19K probably benign Het
Acsm1 A G 7: 119,656,051 T392A probably benign Het
Adam19 A T 11: 46,125,026 I338F probably damaging Het
Adamdec1 C T 14: 68,570,163 M349I probably damaging Het
Arhgef11 T A 3: 87,679,752 probably benign Het
Bptf T C 11: 107,073,295 D1628G probably benign Het
Camk2d C T 3: 126,597,482 Q15* probably null Het
Camk2g T G 14: 20,793,931 D12A possibly damaging Het
Cgn T C 3: 94,779,990 M1V probably null Het
Dcbld1 C A 10: 52,284,257 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Espl1 T A 15: 102,312,518 L903Q probably damaging Het
Gm11639 T G 11: 104,753,806 probably null Het
Gm5117 T A 8: 31,737,882 noncoding transcript Het
Gm5150 T C 3: 15,963,424 T228A probably benign Het
Gm5435 A T 12: 82,496,476 noncoding transcript Het
Gpr156 T A 16: 38,005,448 C676S probably benign Het
Gstt3 C T 10: 75,774,851 E230K possibly damaging Het
Jarid2 A G 13: 44,906,271 I660V possibly damaging Het
Kif13a A G 13: 46,775,401 probably null Het
Kntc1 T A 5: 123,764,191 V299D probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipk T A 19: 34,020,213 probably null Het
Loxhd1 T C 18: 77,332,682 L334P probably damaging Het
Macc1 T A 12: 119,446,477 Y327N probably damaging Het
Man2a2 G A 7: 80,361,128 S705L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Ncam2 A T 16: 81,434,819 Q57L probably damaging Het
Nedd1 T C 10: 92,686,240 E645G probably damaging Het
Nfatc1 A T 18: 80,708,117 M1K probably null Het
Nlrp9b A T 7: 20,023,991 R384S probably damaging Het
Nrxn3 A G 12: 89,813,584 H62R possibly damaging Het
Olfr1097 A G 2: 86,890,620 L185S probably damaging Het
Olfr1233 T A 2: 89,339,459 Y281F probably damaging Het
Olfr640 T C 7: 104,021,997 H107R probably damaging Het
Olfr753-ps1 T A 17: 37,170,000 Y216F probably damaging Het
Olfr887 A T 9: 38,085,126 M97L probably benign Het
Pdzph1 T A 17: 58,974,880 I136F probably damaging Het
Pigg T C 5: 108,314,160 I119T probably damaging Het
R3hdm2 A G 10: 127,458,893 H215R probably damaging Het
Sept14 C T 5: 129,685,914 probably null Het
Slc9a3 T C 13: 74,150,960 M166T possibly damaging Het
Spock3 A G 8: 63,345,782 D279G probably damaging Het
Suco T C 1: 161,833,430 I967V probably damaging Het
Tgtp1 A G 11: 48,987,176 L234P probably damaging Het
Tmem176a A G 6: 48,842,217 D4G probably benign Het
Tmem2 T C 19: 21,798,329 I312T probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Uox A G 3: 146,624,545 D152G probably damaging Het
Vmn1r35 C T 6: 66,679,506 W60* probably null Het
Vmn2r103 T C 17: 19,812,171 C736R probably damaging Het
Other mutations in Clec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Clec16a APN 16 10595896 missense probably damaging 1.00
IGL00503:Clec16a APN 16 10694649 missense possibly damaging 0.53
IGL01622:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL01623:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL02008:Clec16a APN 16 10580960 missense probably damaging 1.00
IGL02082:Clec16a APN 16 10614568 missense probably damaging 1.00
IGL02468:Clec16a APN 16 10741878 missense probably benign 0.13
IGL02499:Clec16a APN 16 10694676 missense probably benign 0.25
IGL02671:Clec16a APN 16 10627381 missense probably benign 0.19
G5030:Clec16a UTSW 16 10571561 missense probably damaging 1.00
IGL03055:Clec16a UTSW 16 10741781 missense probably damaging 0.99
P0014:Clec16a UTSW 16 10560156 splice site probably benign
R0183:Clec16a UTSW 16 10560022 missense probably damaging 1.00
R0268:Clec16a UTSW 16 10644828 nonsense probably null
R0512:Clec16a UTSW 16 10614580 missense probably damaging 1.00
R0556:Clec16a UTSW 16 10638785 critical splice acceptor site probably null
R0944:Clec16a UTSW 16 10688646 splice site probably benign
R1456:Clec16a UTSW 16 10691555 missense probably damaging 1.00
R1497:Clec16a UTSW 16 10635259 missense probably damaging 1.00
R1580:Clec16a UTSW 16 10595898 missense probably damaging 1.00
R1933:Clec16a UTSW 16 10688539 missense probably damaging 0.99
R2075:Clec16a UTSW 16 10741616 missense probably benign 0.09
R2269:Clec16a UTSW 16 10644786 missense probably damaging 1.00
R2504:Clec16a UTSW 16 10559687 intron probably benign
R3011:Clec16a UTSW 16 10611111 missense probably benign 0.01
R4331:Clec16a UTSW 16 10571669 missense probably benign
R4616:Clec16a UTSW 16 10644883 critical splice donor site probably null
R4775:Clec16a UTSW 16 10638914 missense probably damaging 1.00
R4969:Clec16a UTSW 16 10568511 missense probably damaging 1.00
R5053:Clec16a UTSW 16 10576597 missense probably damaging 1.00
R5170:Clec16a UTSW 16 10741791 missense probably benign
R5331:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5332:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5417:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5419:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5420:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5457:Clec16a UTSW 16 10545532 unclassified probably null
R5623:Clec16a UTSW 16 10611121 missense probably benign 0.07
R6057:Clec16a UTSW 16 10630087 missense probably damaging 1.00
R6184:Clec16a UTSW 16 10572928 splice site probably null
R6235:Clec16a UTSW 16 10694635 missense probably damaging 1.00
R6260:Clec16a UTSW 16 10694848 intron probably benign
R6292:Clec16a UTSW 16 10560151 critical splice donor site probably null
R6318:Clec16a UTSW 16 10630788 missense probably damaging 1.00
R6894:Clec16a UTSW 16 10644854 missense probably damaging 1.00
R7340:Clec16a UTSW 16 10580963 missense probably null 0.21
R7432:Clec16a UTSW 16 10688555 missense possibly damaging 0.62
R7453:Clec16a UTSW 16 10644822 missense probably damaging 1.00
R7536:Clec16a UTSW 16 10638844 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAAGTCCAGTCGAGTTGTCTTG -3'
(R):5'- CTGTGGGTCAGAGGTCATAGTC -3'

Sequencing Primer
(F):5'- GAGTTGTCTTGACATTAAAGCCCC -3'
(R):5'- TCATAGTCGAAACAAGGGGTCAC -3'
Posted On2016-08-04