Incidental Mutation 'R5329:Gpr156'
ID422244
Institutional Source Beutler Lab
Gene Symbol Gpr156
Ensembl Gene ENSMUSG00000046961
Gene NameG protein-coupled receptor 156
SynonymsGababl
MMRRC Submission 042911-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5329 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location37916496-38007530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38005448 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 676 (C676S)
Ref Sequence ENSEMBL: ENSMUSP00000055958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061274]
Predicted Effect probably benign
Transcript: ENSMUST00000061274
AA Change: C676S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000055958
Gene: ENSMUSG00000046961
AA Change: C676S

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Pfam:7tm_3 61 313 2.6e-37 PFAM
coiled coil region 353 390 N/A INTRINSIC
low complexity region 584 593 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
low complexity region 681 716 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G protein-coupled receptors (GPCRs) are a large superfamily of cell surface receptors characterized by 7 helical transmembrane domains, together with N-terminal extracellular and C-terminal intracellular domains.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik G A 4: 153,959,827 V32I probably benign Het
Abcg4 A T 9: 44,279,545 M19K probably benign Het
Acsm1 A G 7: 119,656,051 T392A probably benign Het
Adam19 A T 11: 46,125,026 I338F probably damaging Het
Adamdec1 C T 14: 68,570,163 M349I probably damaging Het
Arhgef11 T A 3: 87,679,752 probably benign Het
Bptf T C 11: 107,073,295 D1628G probably benign Het
Camk2d C T 3: 126,597,482 Q15* probably null Het
Camk2g T G 14: 20,793,931 D12A possibly damaging Het
Cgn T C 3: 94,779,990 M1V probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Dcbld1 C A 10: 52,284,257 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Espl1 T A 15: 102,312,518 L903Q probably damaging Het
Gm11639 T G 11: 104,753,806 probably null Het
Gm5117 T A 8: 31,737,882 noncoding transcript Het
Gm5150 T C 3: 15,963,424 T228A probably benign Het
Gm5435 A T 12: 82,496,476 noncoding transcript Het
Gstt3 C T 10: 75,774,851 E230K possibly damaging Het
Jarid2 A G 13: 44,906,271 I660V possibly damaging Het
Kif13a A G 13: 46,775,401 probably null Het
Kntc1 T A 5: 123,764,191 V299D probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipk T A 19: 34,020,213 probably null Het
Loxhd1 T C 18: 77,332,682 L334P probably damaging Het
Macc1 T A 12: 119,446,477 Y327N probably damaging Het
Man2a2 G A 7: 80,361,128 S705L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Ncam2 A T 16: 81,434,819 Q57L probably damaging Het
Nedd1 T C 10: 92,686,240 E645G probably damaging Het
Nfatc1 A T 18: 80,708,117 M1K probably null Het
Nlrp9b A T 7: 20,023,991 R384S probably damaging Het
Nrxn3 A G 12: 89,813,584 H62R possibly damaging Het
Olfr1097 A G 2: 86,890,620 L185S probably damaging Het
Olfr1233 T A 2: 89,339,459 Y281F probably damaging Het
Olfr640 T C 7: 104,021,997 H107R probably damaging Het
Olfr753-ps1 T A 17: 37,170,000 Y216F probably damaging Het
Olfr887 A T 9: 38,085,126 M97L probably benign Het
Pdzph1 T A 17: 58,974,880 I136F probably damaging Het
Pigg T C 5: 108,314,160 I119T probably damaging Het
R3hdm2 A G 10: 127,458,893 H215R probably damaging Het
Sept14 C T 5: 129,685,914 probably null Het
Slc9a3 T C 13: 74,150,960 M166T possibly damaging Het
Spock3 A G 8: 63,345,782 D279G probably damaging Het
Suco T C 1: 161,833,430 I967V probably damaging Het
Tgtp1 A G 11: 48,987,176 L234P probably damaging Het
Tmem176a A G 6: 48,842,217 D4G probably benign Het
Tmem2 T C 19: 21,798,329 I312T probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Uox A G 3: 146,624,545 D152G probably damaging Het
Vmn1r35 C T 6: 66,679,506 W60* probably null Het
Vmn2r103 T C 17: 19,812,171 C736R probably damaging Het
Other mutations in Gpr156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Gpr156 APN 16 37988576 missense probably damaging 1.00
IGL01615:Gpr156 APN 16 37988591 missense probably damaging 1.00
IGL01976:Gpr156 APN 16 37979033 missense probably damaging 0.97
IGL02217:Gpr156 APN 16 38005311 missense probably benign 0.19
IGL02515:Gpr156 APN 16 38005679 missense probably damaging 0.97
IGL02596:Gpr156 APN 16 37978724 missense probably benign 0.00
IGL03068:Gpr156 APN 16 37992129 missense probably damaging 0.99
R0690:Gpr156 UTSW 16 37992141 missense probably damaging 1.00
R1034:Gpr156 UTSW 16 38004726 missense probably benign
R1133:Gpr156 UTSW 16 38005321 missense probably benign 0.10
R1317:Gpr156 UTSW 16 37987567 missense probably damaging 1.00
R1437:Gpr156 UTSW 16 37988542 missense probably damaging 0.99
R1484:Gpr156 UTSW 16 37992196 missense probably damaging 0.99
R1759:Gpr156 UTSW 16 37948221 missense probably damaging 0.96
R1761:Gpr156 UTSW 16 37987567 missense probably damaging 1.00
R1998:Gpr156 UTSW 16 37997908 missense possibly damaging 0.57
R2067:Gpr156 UTSW 16 37978751 missense probably benign 0.02
R2111:Gpr156 UTSW 16 37978751 missense probably benign 0.02
R2509:Gpr156 UTSW 16 37947787 missense probably benign 0.04
R2872:Gpr156 UTSW 16 37992223 missense probably damaging 0.99
R2872:Gpr156 UTSW 16 37992223 missense probably damaging 0.99
R3839:Gpr156 UTSW 16 37988600 missense probably damaging 0.99
R4492:Gpr156 UTSW 16 37992106 missense probably damaging 0.99
R4988:Gpr156 UTSW 16 37948215 missense possibly damaging 0.71
R5361:Gpr156 UTSW 16 38005725 missense probably damaging 0.99
R5386:Gpr156 UTSW 16 37948309 missense possibly damaging 0.93
R5531:Gpr156 UTSW 16 38005257 missense probably benign 0.01
R5886:Gpr156 UTSW 16 37979013 missense probably damaging 1.00
R5942:Gpr156 UTSW 16 38004902 missense probably benign 0.04
R6345:Gpr156 UTSW 16 37987519 missense probably damaging 1.00
R7247:Gpr156 UTSW 16 37947741 missense probably damaging 1.00
R7353:Gpr156 UTSW 16 37992161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTTATTGTACAGAACAGAGAC -3'
(R):5'- AGCAGATTTCACAGTAGGGCC -3'

Sequencing Primer
(F):5'- TTATTGTACAGAACAGAGACAGTCCC -3'
(R):5'- AAGAACTCGTCTGAGCTGCTG -3'
Posted On2016-08-04