Incidental Mutation 'R5329:Vmn2r103'
ID422246
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Namevomeronasal 2, receptor 103
SynonymsEG627636
MMRRC Submission 042911-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5329 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19773363-19812536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19812171 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 736 (C736R)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
Predicted Effect probably damaging
Transcript: ENSMUST00000172203
AA Change: C736R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: C736R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430005L14Rik G A 4: 153,959,827 V32I probably benign Het
Abcg4 A T 9: 44,279,545 M19K probably benign Het
Acsm1 A G 7: 119,656,051 T392A probably benign Het
Adam19 A T 11: 46,125,026 I338F probably damaging Het
Adamdec1 C T 14: 68,570,163 M349I probably damaging Het
Arhgef11 T A 3: 87,679,752 probably benign Het
Bptf T C 11: 107,073,295 D1628G probably benign Het
Camk2d C T 3: 126,597,482 Q15* probably null Het
Camk2g T G 14: 20,793,931 D12A possibly damaging Het
Cgn T C 3: 94,779,990 M1V probably null Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Dcbld1 C A 10: 52,284,257 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Espl1 T A 15: 102,312,518 L903Q probably damaging Het
Gm11639 T G 11: 104,753,806 probably null Het
Gm5117 T A 8: 31,737,882 noncoding transcript Het
Gm5150 T C 3: 15,963,424 T228A probably benign Het
Gm5435 A T 12: 82,496,476 noncoding transcript Het
Gpr156 T A 16: 38,005,448 C676S probably benign Het
Gstt3 C T 10: 75,774,851 E230K possibly damaging Het
Jarid2 A G 13: 44,906,271 I660V possibly damaging Het
Kif13a A G 13: 46,775,401 probably null Het
Kntc1 T A 5: 123,764,191 V299D probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipk T A 19: 34,020,213 probably null Het
Loxhd1 T C 18: 77,332,682 L334P probably damaging Het
Macc1 T A 12: 119,446,477 Y327N probably damaging Het
Man2a2 G A 7: 80,361,128 S705L possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Ncam2 A T 16: 81,434,819 Q57L probably damaging Het
Nedd1 T C 10: 92,686,240 E645G probably damaging Het
Nfatc1 A T 18: 80,708,117 M1K probably null Het
Nlrp9b A T 7: 20,023,991 R384S probably damaging Het
Nrxn3 A G 12: 89,813,584 H62R possibly damaging Het
Olfr1097 A G 2: 86,890,620 L185S probably damaging Het
Olfr1233 T A 2: 89,339,459 Y281F probably damaging Het
Olfr640 T C 7: 104,021,997 H107R probably damaging Het
Olfr753-ps1 T A 17: 37,170,000 Y216F probably damaging Het
Olfr887 A T 9: 38,085,126 M97L probably benign Het
Pdzph1 T A 17: 58,974,880 I136F probably damaging Het
Pigg T C 5: 108,314,160 I119T probably damaging Het
R3hdm2 A G 10: 127,458,893 H215R probably damaging Het
Sept14 C T 5: 129,685,914 probably null Het
Slc9a3 T C 13: 74,150,960 M166T possibly damaging Het
Spock3 A G 8: 63,345,782 D279G probably damaging Het
Suco T C 1: 161,833,430 I967V probably damaging Het
Tgtp1 A G 11: 48,987,176 L234P probably damaging Het
Tmem176a A G 6: 48,842,217 D4G probably benign Het
Tmem2 T C 19: 21,798,329 I312T probably benign Het
Ugt1a10 G A 1: 88,216,254 A199T probably damaging Het
Uox A G 3: 146,624,545 D152G probably damaging Het
Vmn1r35 C T 6: 66,679,506 W60* probably null Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1488:Vmn2r103 UTSW 17 19793660 missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 19794234 missense probably benign
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 19793794 missense probably benign
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 19793600 missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 19792989 missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 19812052 missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 19794214 missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R7968:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 19799249 missense not run
R8031:Vmn2r103 UTSW 17 19793497 missense not run
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGCTATTACTGTGGTCCTTGCC -3'
(R):5'- CTTCCCTTTAGTGCTGTGGAAG -3'

Sequencing Primer
(F):5'- GCCTTTAAGGTCAGTTTTCCAG -3'
(R):5'- GACAGGCAGAAAAGTGACCC -3'
Posted On2016-08-04