Incidental Mutation 'R5340:Aqp7'
ID422268
Institutional Source Beutler Lab
Gene Symbol Aqp7
Ensembl Gene ENSMUSG00000028427
Gene Nameaquaporin 7
SynonymsAQPap, AQP7L
MMRRC Submission 042919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5340 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41033074-41048139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41034347 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 271 (R271G)
Ref Sequence ENSEMBL: ENSMUSP00000093007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030136] [ENSMUST00000054945]
Predicted Effect probably benign
Transcript: ENSMUST00000030136
AA Change: R271G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030136
Gene: ENSMUSG00000028427
AA Change: R271G

DomainStartEndE-ValueType
Pfam:MIP 12 257 7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054945
AA Change: R271G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093007
Gene: ENSMUSG00000028427
AA Change: R271G

DomainStartEndE-ValueType
Pfam:MIP 12 257 1.6e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149517
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aquaporin family of water-selective membrane channels. The encoded protein localizes to the plasma membrane and allows movement of water, glycerol and urea across cell membranes. This gene is highly expressed in the adipose tissue where the encoded protein facilitates efflux of glycerol. In the proximal straight tubules of kidney, the encoded protein is localized to the apical membrane and prevents excretion of glycerol into urine. The encoded protein is present in spermatids, as well as in the testicular and epididymal spermatozoa suggesting an important role in late spermatogenesis. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related aquaporin gene on chromosome 9. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice for one allele show decreased circulating glycerol levels and fasting hypoglycemia. Other mutant alleles show increased gonadal fat pad mass and adipocyte hypertrophy or increased urine glucose and impaired water permeability in the kidney, but have normal serum glycerol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik C T 13: 98,984,443 R25H possibly damaging Het
Atp4a A G 7: 30,720,806 I793V probably benign Het
Baz2a C T 10: 128,115,042 R535C probably damaging Het
BC034090 T C 1: 155,226,414 T35A possibly damaging Het
Bnip1 T C 17: 26,786,790 probably null Het
Ccdc136 A G 6: 29,411,860 S369G possibly damaging Het
Csrnp3 A G 2: 66,022,437 D391G probably benign Het
Ctbp2 G T 7: 133,013,963 H414Q probably benign Het
Dnah6 A G 6: 73,212,620 I15T probably benign Het
Dync2li1 A G 17: 84,649,702 probably null Het
Eri3 A T 4: 117,673,794 I329F probably damaging Het
Fam105a T C 15: 27,658,089 M282V possibly damaging Het
Flii T A 11: 60,717,268 I786F probably damaging Het
Fmo1 A T 1: 162,829,982 I530N probably benign Het
Gm10334 T C 6: 41,445,373 N33D probably benign Het
Gm28042 T C 2: 120,041,448 S960P probably benign Het
Gzmm C A 10: 79,695,073 F236L probably benign Het
Igkv4-55 A G 6: 69,607,505 V41A probably damaging Het
Ipo9 A G 1: 135,385,432 Y1020H probably benign Het
Masp1 T C 16: 23,458,108 Y549C probably damaging Het
Mblac1 A T 5: 138,194,578 S61C probably damaging Het
Mical1 T A 10: 41,483,431 probably null Het
Mroh9 C T 1: 163,080,587 probably benign Het
Mta2 T C 19: 8,942,356 M1T probably null Het
Neb A G 2: 52,223,048 Y4245H probably damaging Het
Olfr1263 T C 2: 90,015,362 V144A probably benign Het
Olfr736 T C 14: 50,393,220 F155L probably damaging Het
Pak2 G T 16: 32,034,946 probably null Het
Phc3 A T 3: 30,907,467 F939I probably damaging Het
Rogdi C A 16: 5,013,361 R14L probably benign Het
Ryr3 T C 2: 112,834,125 Y1627C probably damaging Het
Scrn3 A T 2: 73,335,810 K396* probably null Het
Sh3pxd2a T C 19: 47,268,231 N683D probably benign Het
Smtnl1 T A 2: 84,815,441 H362L probably damaging Het
Sned1 A G 1: 93,282,757 S927G probably benign Het
Tcaf1 A G 6: 42,678,989 V351A probably damaging Het
Tmem232 C T 17: 65,402,998 V432M possibly damaging Het
Ttll11 G T 2: 35,902,789 H347Q probably damaging Het
Vmn2r56 A C 7: 12,715,872 D146E probably damaging Het
Wwp1 A G 4: 19,638,773 probably null Het
Zcchc7 T A 4: 44,762,245 N124K probably benign Het
Zfp667 A G 7: 6,305,253 T307A possibly damaging Het
Zfp709 T A 8: 71,889,752 C342S probably damaging Het
Zfp940 A G 7: 29,844,841 V547A probably benign Het
Other mutations in Aqp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Aqp7 APN 4 41045321 nonsense probably null
IGL01871:Aqp7 APN 4 41045321 nonsense probably null
IGL02173:Aqp7 APN 4 41034379 nonsense probably null
IGL03139:Aqp7 APN 4 41045326 missense probably benign 0.00
IGL03237:Aqp7 APN 4 41034884 missense possibly damaging 0.68
IGL03241:Aqp7 APN 4 41045270 splice site probably benign
acadia UTSW 4 41035510 missense probably benign 0.00
IGL03055:Aqp7 UTSW 4 41045326 missense probably benign 0.00
R0884:Aqp7 UTSW 4 41034929 missense possibly damaging 0.86
R1617:Aqp7 UTSW 4 41036109 missense probably null 0.74
R3551:Aqp7 UTSW 4 41045329 missense probably benign 0.04
R5689:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5690:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5691:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5692:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5710:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5711:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5713:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5751:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5817:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5820:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5921:Aqp7 UTSW 4 41036093 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGTTCAGCTGCAGGAGATC -3'
(R):5'- TTAGGGTAAATGGTCTCCCTCTG -3'

Sequencing Primer
(F):5'- TTCAGCTGCAGGAGATCCCAAG -3'
(R):5'- GTAAATGGTCTCCCTCTGTTGGTC -3'
Posted On2016-08-04