Incidental Mutation 'R5340:Fam105a'
ID422293
Institutional Source Beutler Lab
Gene Symbol Fam105a
Ensembl Gene ENSMUSG00000056069
Gene Namefamily with sequence similarity 105, member A
Synonyms
MMRRC Submission 042919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5340 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location27655069-27681579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27658089 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 282 (M282V)
Ref Sequence ENSEMBL: ENSMUSP00000153902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100739] [ENSMUST00000226145] [ENSMUST00000226170] [ENSMUST00000226581]
Predicted Effect probably benign
Transcript: ENSMUST00000100739
AA Change: M232V

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098305
Gene: ENSMUSG00000056069
AA Change: M232V

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Peptidase_C101 85 114 4e-10 PFAM
Pfam:Peptidase_C101 112 302 1.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226145
AA Change: M282V

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226170
AA Change: M282V

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000226581
AA Change: M112V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000231473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232492
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik C T 13: 98,984,443 R25H possibly damaging Het
Aqp7 T C 4: 41,034,347 R271G probably benign Het
Atp4a A G 7: 30,720,806 I793V probably benign Het
Baz2a C T 10: 128,115,042 R535C probably damaging Het
BC034090 T C 1: 155,226,414 T35A possibly damaging Het
Bnip1 T C 17: 26,786,790 probably null Het
Ccdc136 A G 6: 29,411,860 S369G possibly damaging Het
Csrnp3 A G 2: 66,022,437 D391G probably benign Het
Ctbp2 G T 7: 133,013,963 H414Q probably benign Het
Dnah6 A G 6: 73,212,620 I15T probably benign Het
Dync2li1 A G 17: 84,649,702 probably null Het
Eri3 A T 4: 117,673,794 I329F probably damaging Het
Flii T A 11: 60,717,268 I786F probably damaging Het
Fmo1 A T 1: 162,829,982 I530N probably benign Het
Gm10334 T C 6: 41,445,373 N33D probably benign Het
Gm28042 T C 2: 120,041,448 S960P probably benign Het
Gzmm C A 10: 79,695,073 F236L probably benign Het
Igkv4-55 A G 6: 69,607,505 V41A probably damaging Het
Ipo9 A G 1: 135,385,432 Y1020H probably benign Het
Masp1 T C 16: 23,458,108 Y549C probably damaging Het
Mblac1 A T 5: 138,194,578 S61C probably damaging Het
Mical1 T A 10: 41,483,431 probably null Het
Mroh9 C T 1: 163,080,587 probably benign Het
Mta2 T C 19: 8,942,356 M1T probably null Het
Neb A G 2: 52,223,048 Y4245H probably damaging Het
Olfr1263 T C 2: 90,015,362 V144A probably benign Het
Olfr736 T C 14: 50,393,220 F155L probably damaging Het
Pak2 G T 16: 32,034,946 probably null Het
Phc3 A T 3: 30,907,467 F939I probably damaging Het
Rogdi C A 16: 5,013,361 R14L probably benign Het
Ryr3 T C 2: 112,834,125 Y1627C probably damaging Het
Scrn3 A T 2: 73,335,810 K396* probably null Het
Sh3pxd2a T C 19: 47,268,231 N683D probably benign Het
Smtnl1 T A 2: 84,815,441 H362L probably damaging Het
Sned1 A G 1: 93,282,757 S927G probably benign Het
Tcaf1 A G 6: 42,678,989 V351A probably damaging Het
Tmem232 C T 17: 65,402,998 V432M possibly damaging Het
Ttll11 G T 2: 35,902,789 H347Q probably damaging Het
Vmn2r56 A C 7: 12,715,872 D146E probably damaging Het
Wwp1 A G 4: 19,638,773 probably null Het
Zcchc7 T A 4: 44,762,245 N124K probably benign Het
Zfp667 A G 7: 6,305,253 T307A possibly damaging Het
Zfp709 T A 8: 71,889,752 C342S probably damaging Het
Zfp940 A G 7: 29,844,841 V547A probably benign Het
Other mutations in Fam105a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Fam105a APN 15 27658116 missense possibly damaging 0.93
IGL01662:Fam105a APN 15 27658065 missense probably damaging 1.00
IGL02991:Fam105a UTSW 15 27658302 missense possibly damaging 0.88
R0349:Fam105a UTSW 15 27664790 missense probably benign 0.01
R0726:Fam105a UTSW 15 27656947 missense probably damaging 1.00
R1054:Fam105a UTSW 15 27664549 missense probably damaging 1.00
R1201:Fam105a UTSW 15 27658173 nonsense probably null
R3001:Fam105a UTSW 15 27664706 missense probably benign 0.00
R3002:Fam105a UTSW 15 27664706 missense probably benign 0.00
R4362:Fam105a UTSW 15 27664343 critical splice donor site probably null
R4363:Fam105a UTSW 15 27664343 critical splice donor site probably null
R5364:Fam105a UTSW 15 27659945 nonsense probably null
R5920:Fam105a UTSW 15 27664356 missense possibly damaging 0.58
R7044:Fam105a UTSW 15 27657235 intron probably benign
R7175:Fam105a UTSW 15 27658288 missense probably damaging 1.00
R7229:Fam105a UTSW 15 27658187 missense probably benign 0.35
R7305:Fam105a UTSW 15 27658233 missense probably benign 0.07
R8346:Fam105a UTSW 15 27664558 missense probably damaging 1.00
X0025:Fam105a UTSW 15 27659942 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTTCACACATGGAGGGC -3'
(R):5'- TAGTGGGATGAGAGATCACCAC -3'

Sequencing Primer
(F):5'- GGCCAGCAATTTTAGCTAGC -3'
(R):5'- GGAGCATGTGTAACAGCCTCTTC -3'
Posted On2016-08-04