Mutagenetix > Incidental Mutation

Incidental Mutation 'R5340:Masp1'

422295

Institutional Source

Beutler Lab

Gene Symbol

Masp1

Ensembl Gene

ENSMUSG00000022887

Gene Name

mannan-binding lectin serine peptidase 1

Synonyms

Crarf

MMRRC Submission

042919-MU

Accession Numbers

Genbank: NM_008555; MGI: 88492

Essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R5340 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23449417-23520815 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23458108 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 549 (Y549C)

Ref Sequence

ENSEMBL: ENSMUSP00000087327 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089883]

AlphaFold

P98064

Predicted Effect

probably damaging
Transcript: ENSMUST00000089883
AA Change: Y549C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: Y549C

Domain	Start	End	E-Value	Type
low complexity region	9	19	N/A	INTRINSIC
CUB	23	143	2.96e-36	SMART
EGF_CA	144	187	1.46e-7	SMART
CUB	190	302	1.49e-41	SMART
CCP	306	367	4.41e-12	SMART
CCP	372	437	3.05e-6	SMART
Tryp_SPc	453	696	4.66e-84	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024P04Rik	C	T	13: 98,984,443	R25H	possibly damaging	Het
Aqp7	T	C	4: 41,034,347	R271G	probably benign	Het
Atp4a	A	G	7: 30,720,806	I793V	probably benign	Het
Baz2a	C	T	10: 128,115,042	R535C	probably damaging	Het
BC034090	T	C	1: 155,226,414	T35A	possibly damaging	Het
Bnip1	T	C	17: 26,786,790		probably null	Het
Ccdc136	A	G	6: 29,411,860	S369G	possibly damaging	Het
Csrnp3	A	G	2: 66,022,437	D391G	probably benign	Het
Ctbp2	G	T	7: 133,013,963	H414Q	probably benign	Het
Dnah6	A	G	6: 73,212,620	I15T	probably benign	Het
Dync2li1	A	G	17: 84,649,702		probably null	Het
Eri3	A	T	4: 117,673,794	I329F	probably damaging	Het
Fam105a	T	C	15: 27,658,089	M282V	possibly damaging	Het
Flii	T	A	11: 60,717,268	I786F	probably damaging	Het
Fmo1	A	T	1: 162,829,982	I530N	probably benign	Het
Gm10334	T	C	6: 41,445,373	N33D	probably benign	Het
Gm28042	T	C	2: 120,041,448	S960P	probably benign	Het
Gzmm	C	A	10: 79,695,073	F236L	probably benign	Het
Igkv4-55	A	G	6: 69,607,505	V41A	probably damaging	Het
Ipo9	A	G	1: 135,385,432	Y1020H	probably benign	Het
Mblac1	A	T	5: 138,194,578	S61C	probably damaging	Het
Mical1	T	A	10: 41,483,431		probably null	Het
Mroh9	C	T	1: 163,080,587		probably benign	Het
Mta2	T	C	19: 8,942,356	M1T	probably null	Het
Neb	A	G	2: 52,223,048	Y4245H	probably damaging	Het
Olfr1263	T	C	2: 90,015,362	V144A	probably benign	Het
Olfr736	T	C	14: 50,393,220	F155L	probably damaging	Het
Pak2	G	T	16: 32,034,946		probably null	Het
Phc3	A	T	3: 30,907,467	F939I	probably damaging	Het
Rogdi	C	A	16: 5,013,361	R14L	probably benign	Het
Ryr3	T	C	2: 112,834,125	Y1627C	probably damaging	Het
Scrn3	A	T	2: 73,335,810	K396*	probably null	Het
Sh3pxd2a	T	C	19: 47,268,231	N683D	probably benign	Het
Smtnl1	T	A	2: 84,815,441	H362L	probably damaging	Het
Sned1	A	G	1: 93,282,757	S927G	probably benign	Het
Tcaf1	A	G	6: 42,678,989	V351A	probably damaging	Het
Tmem232	C	T	17: 65,402,998	V432M	possibly damaging	Het
Ttll11	G	T	2: 35,902,789	H347Q	probably damaging	Het
Vmn2r56	A	C	7: 12,715,872	D146E	probably damaging	Het
Wwp1	A	G	4: 19,638,773		probably null	Het
Zcchc7	T	A	4: 44,762,245	N124K	probably benign	Het
Zfp667	A	G	7: 6,305,253	T307A	possibly damaging	Het
Zfp709	T	A	8: 71,889,752	C342S	probably damaging	Het
Zfp940	A	G	7: 29,844,841	V547A	probably benign	Het

Other mutations in Masp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Masp1	APN	16	23458091	missense	possibly damaging	0.93
IGL00428:Masp1	APN	16	23476312	missense	probably damaging	1.00
IGL00432:Masp1	APN	16	23513851	missense	probably damaging	1.00
IGL02598:Masp1	APN	16	23459631	missense	probably benign
IGL02718:Masp1	APN	16	23476293	missense	probably damaging	1.00
IGL02947:Masp1	APN	16	23494726	missense	probably damaging	0.99
A4554:Masp1	UTSW	16	23454940	splice site	probably null
PIT1430001:Masp1	UTSW	16	23513944	missense	probably damaging	1.00
R0103:Masp1	UTSW	16	23458018	missense	probably damaging	1.00
R0505:Masp1	UTSW	16	23458138	missense	probably benign
R0630:Masp1	UTSW	16	23452419	missense	probably benign	0.01
R1146:Masp1	UTSW	16	23492115	missense	probably damaging	1.00
R1146:Masp1	UTSW	16	23492115	missense	probably damaging	1.00
R1339:Masp1	UTSW	16	23452467	missense	probably damaging	1.00
R1521:Masp1	UTSW	16	23494637	missense	probably damaging	1.00
R1588:Masp1	UTSW	16	23494654	missense	probably damaging	1.00
R1961:Masp1	UTSW	16	23452932	missense	probably damaging	1.00
R1986:Masp1	UTSW	16	23483461	missense	probably benign	0.01
R2080:Masp1	UTSW	16	23491959	missense	probably damaging	1.00
R2215:Masp1	UTSW	16	23452521	missense	possibly damaging	0.92
R2216:Masp1	UTSW	16	23492055	missense	probably benign	0.00
R2443:Masp1	UTSW	16	23476312	missense	probably damaging	1.00
R4934:Masp1	UTSW	16	23465076	missense	probably damaging	0.98
R5224:Masp1	UTSW	16	23494695	missense	probably damaging	1.00
R5562:Masp1	UTSW	16	23465167	splice site	probably null
R5663:Masp1	UTSW	16	23452938	missense	possibly damaging	0.57
R5742:Masp1	UTSW	16	23454925	missense	probably benign	0.01
R5763:Masp1	UTSW	16	23496247	missense	probably damaging	1.00
R5898:Masp1	UTSW	16	23491927	missense	probably damaging	0.99
R6901:Masp1	UTSW	16	23513834	missense	probably damaging	0.99
R6987:Masp1	UTSW	16	23513915	missense	probably damaging	1.00
R7069:Masp1	UTSW	16	23452455	missense	probably benign	0.20
R7356:Masp1	UTSW	16	23470243	missense	possibly damaging	0.50
R7512:Masp1	UTSW	16	23470124	missense	probably damaging	1.00
R7539:Masp1	UTSW	16	23470378	missense	possibly damaging	0.94
R7810:Masp1	UTSW	16	23476318	missense	probably benign	0.01
R8026:Masp1	UTSW	16	23484406	missense	probably damaging	1.00
R8391:Masp1	UTSW	16	23470378	missense	possibly damaging	0.94
R8438:Masp1	UTSW	16	23470403	missense	probably benign	0.38
R8475:Masp1	UTSW	16	23452531	missense	probably damaging	0.99
R8870:Masp1	UTSW	16	23496132	missense	probably damaging	1.00
R9052:Masp1	UTSW	16	23520600	start gained	probably benign
R9072:Masp1	UTSW	16	23469921	missense	probably benign	0.07
R9073:Masp1	UTSW	16	23469921	missense	probably benign	0.07
R9599:Masp1	UTSW	16	23452948	missense	probably benign	0.16
R9686:Masp1	UTSW	16	23496137	missense	probably damaging	1.00
X0065:Masp1	UTSW	16	23513969	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGGTCAGGGGACAGATAC -3'
(R):5'- GGAACCATGAGCCTATGAGG -3'

Sequencing Primer
(F):5'- CTGACTTTCTTCAGTGAAGACCAG -3'
(R):5'- CCATGAGCCTATGAGGGGTATG -3'

Posted On

2016-08-04