Incidental Mutation 'R5340:Bnip1'
ID422297
Institutional Source Beutler Lab
Gene Symbol Bnip1
Ensembl Gene ENSMUSG00000024191
Gene NameBCL2/adenovirus E1B interacting protein 1
Synonyms
MMRRC Submission 042919-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5340 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26781079-26792565 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 26786790 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015725] [ENSMUST00000126505] [ENSMUST00000135824] [ENSMUST00000135824]
Predicted Effect probably null
Transcript: ENSMUST00000015725
SMART Domains Protein: ENSMUSP00000015725
Gene: ENSMUSG00000024191

DomainStartEndE-ValueType
coiled coil region 37 89 N/A INTRINSIC
Pfam:Sec20 133 224 2.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131362
Predicted Effect probably benign
Transcript: ENSMUST00000134344
SMART Domains Protein: ENSMUSP00000122734
Gene: ENSMUSG00000024191

DomainStartEndE-ValueType
coiled coil region 27 79 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135824
SMART Domains Protein: ENSMUSP00000118933
Gene: ENSMUSG00000024191

DomainStartEndE-ValueType
coiled coil region 37 90 N/A INTRINSIC
Pfam:Sec20 99 190 1.4e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135824
SMART Domains Protein: ENSMUSP00000118933
Gene: ENSMUSG00000024191

DomainStartEndE-ValueType
coiled coil region 37 90 N/A INTRINSIC
Pfam:Sec20 99 190 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135899
Predicted Effect probably benign
Transcript: ENSMUST00000137989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147516
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. In addition, this protein is involved in vesicle transport into the endoplasmic reticulum. Alternative splicing of this gene results in four protein products with identical N- and C-termini. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik C T 13: 98,984,443 R25H possibly damaging Het
Aqp7 T C 4: 41,034,347 R271G probably benign Het
Atp4a A G 7: 30,720,806 I793V probably benign Het
Baz2a C T 10: 128,115,042 R535C probably damaging Het
BC034090 T C 1: 155,226,414 T35A possibly damaging Het
Ccdc136 A G 6: 29,411,860 S369G possibly damaging Het
Csrnp3 A G 2: 66,022,437 D391G probably benign Het
Ctbp2 G T 7: 133,013,963 H414Q probably benign Het
Dnah6 A G 6: 73,212,620 I15T probably benign Het
Dync2li1 A G 17: 84,649,702 probably null Het
Eri3 A T 4: 117,673,794 I329F probably damaging Het
Fam105a T C 15: 27,658,089 M282V possibly damaging Het
Flii T A 11: 60,717,268 I786F probably damaging Het
Fmo1 A T 1: 162,829,982 I530N probably benign Het
Gm10334 T C 6: 41,445,373 N33D probably benign Het
Gm28042 T C 2: 120,041,448 S960P probably benign Het
Gzmm C A 10: 79,695,073 F236L probably benign Het
Igkv4-55 A G 6: 69,607,505 V41A probably damaging Het
Ipo9 A G 1: 135,385,432 Y1020H probably benign Het
Masp1 T C 16: 23,458,108 Y549C probably damaging Het
Mblac1 A T 5: 138,194,578 S61C probably damaging Het
Mical1 T A 10: 41,483,431 probably null Het
Mroh9 C T 1: 163,080,587 probably benign Het
Mta2 T C 19: 8,942,356 M1T probably null Het
Neb A G 2: 52,223,048 Y4245H probably damaging Het
Olfr1263 T C 2: 90,015,362 V144A probably benign Het
Olfr736 T C 14: 50,393,220 F155L probably damaging Het
Pak2 G T 16: 32,034,946 probably null Het
Phc3 A T 3: 30,907,467 F939I probably damaging Het
Rogdi C A 16: 5,013,361 R14L probably benign Het
Ryr3 T C 2: 112,834,125 Y1627C probably damaging Het
Scrn3 A T 2: 73,335,810 K396* probably null Het
Sh3pxd2a T C 19: 47,268,231 N683D probably benign Het
Smtnl1 T A 2: 84,815,441 H362L probably damaging Het
Sned1 A G 1: 93,282,757 S927G probably benign Het
Tcaf1 A G 6: 42,678,989 V351A probably damaging Het
Tmem232 C T 17: 65,402,998 V432M possibly damaging Het
Ttll11 G T 2: 35,902,789 H347Q probably damaging Het
Vmn2r56 A C 7: 12,715,872 D146E probably damaging Het
Wwp1 A G 4: 19,638,773 probably null Het
Zcchc7 T A 4: 44,762,245 N124K probably benign Het
Zfp667 A G 7: 6,305,253 T307A possibly damaging Het
Zfp709 T A 8: 71,889,752 C342S probably damaging Het
Zfp940 A G 7: 29,844,841 V547A probably benign Het
Other mutations in Bnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0830:Bnip1 UTSW 17 26789705 missense probably benign
R4918:Bnip1 UTSW 17 26783551 splice site probably benign
R6329:Bnip1 UTSW 17 26786710 nonsense probably null
R6522:Bnip1 UTSW 17 26789745 missense probably damaging 0.96
X0063:Bnip1 UTSW 17 26786784 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTCTGTTGTAAAGGACGCTTCAG -3'
(R):5'- TATGCAGACAACATGAGCACTG -3'

Sequencing Primer
(F):5'- AAAGGACGCTTCAGTTACTTTTGTGC -3'
(R):5'- TGAGCACTGTCAACACACTCAG -3'
Posted On2016-08-04