Incidental Mutation 'R5341:Zdbf2'
ID 422305
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 042920-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R5341 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63347092 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1824 (S1824T)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect probably benign
Transcript: ENSMUST00000029025
AA Change: S1824T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: S1824T

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114132
AA Change: S1824T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: S1824T

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.1067 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb3 A G 10: 85,223,236 (GRCm39) D15G unknown Het
Actr5 C A 2: 158,467,144 (GRCm39) S28* probably null Het
Adcy1 A C 11: 7,080,375 (GRCm39) M373L probably damaging Het
Adcyap1r1 C G 6: 55,455,054 (GRCm39) F111L probably benign Het
Arid5b A T 10: 68,113,957 (GRCm39) F27I possibly damaging Het
Art5 C A 7: 101,747,306 (GRCm39) V158L probably benign Het
Bora T A 14: 99,305,530 (GRCm39) Y300N probably damaging Het
Cd300a A G 11: 114,784,288 (GRCm39) T99A probably damaging Het
Cdon A G 9: 35,381,431 (GRCm39) Y607C probably damaging Het
Cenatac A G 9: 44,328,406 (GRCm39) probably null Het
Cpxm2 T A 7: 131,756,342 (GRCm39) probably benign Het
Cstdc7 A G 18: 42,306,496 (GRCm39) D21G possibly damaging Het
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGACCGGGAC 11: 101,629,016 (GRCm39) probably benign Het
Dync2i1 T C 12: 116,219,534 (GRCm39) E136G possibly damaging Het
Enox1 A C 14: 77,815,096 (GRCm39) T85P possibly damaging Het
Fanci T C 7: 79,055,926 (GRCm39) L158P probably damaging Het
Gbgt1 C A 2: 28,395,019 (GRCm39) T219N probably damaging Het
Gulo T C 14: 66,225,707 (GRCm39) D373G probably benign Het
Hivep2 C A 10: 14,008,336 (GRCm39) Q1645K possibly damaging Het
Iqce A C 5: 140,675,814 (GRCm39) M114R possibly damaging Het
Lmbrd1 A T 1: 24,785,892 (GRCm39) K396* probably null Het
Lrrk2 A T 15: 91,657,061 (GRCm39) D1785V probably damaging Het
Matcap1 A T 8: 106,011,687 (GRCm39) M226K probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 10,011,142 (GRCm39) probably null Het
Mepce A G 5: 137,781,522 (GRCm39) V564A probably damaging Het
Mmp17 A T 5: 129,679,193 (GRCm39) D364V possibly damaging Het
Mrgpre T C 7: 143,335,246 (GRCm39) N86D probably benign Het
Ms4a20 T C 19: 11,087,745 (GRCm39) probably benign Het
Or2r11 A T 6: 42,437,098 (GRCm39) L285Q probably damaging Het
Or4f53 T A 2: 111,087,982 (GRCm39) I174K probably damaging Het
Pate11 A T 9: 36,388,357 (GRCm39) K61* probably null Het
Pax5 T C 4: 44,697,630 (GRCm39) D35G probably damaging Het
Pip5k1b T A 19: 24,281,440 (GRCm39) T473S probably benign Het
Pkd2l2 A G 18: 34,542,987 (GRCm39) probably null Het
Pygo2 C A 3: 89,340,067 (GRCm39) P155Q probably damaging Het
Rb1cc1 G T 1: 6,285,266 (GRCm39) probably benign Het
Rbpj A G 5: 53,799,425 (GRCm39) E80G possibly damaging Het
Sbno1 A C 5: 124,546,538 (GRCm39) probably null Het
Slc1a1 T A 19: 28,874,968 (GRCm39) V182E probably benign Het
Slc34a3 A T 2: 25,120,671 (GRCm39) F419I probably benign Het
Snx8 A G 5: 140,343,886 (GRCm39) V62A probably damaging Het
Sp9 T C 2: 73,104,858 (GRCm39) S471P possibly damaging Het
Sspo A T 6: 48,436,549 (GRCm39) S1270C probably damaging Het
Stk11 A T 10: 79,962,094 (GRCm39) T83S probably benign Het
Syt13 A G 2: 92,783,897 (GRCm39) E389G probably benign Het
Taf10 T C 7: 105,390,139 (GRCm39) probably benign Het
Tgm1 A T 14: 55,937,705 (GRCm39) S801R possibly damaging Het
Thoc2l A T 5: 104,665,942 (GRCm39) T155S probably damaging Het
Timeless T C 10: 128,083,047 (GRCm39) F628L possibly damaging Het
Tmem171 G T 13: 98,824,956 (GRCm39) P225T probably damaging Het
Tspan12 A T 6: 21,835,458 (GRCm39) C72S possibly damaging Het
Txk T C 5: 72,853,964 (GRCm39) T458A probably benign Het
Txndc9 A G 1: 38,026,704 (GRCm39) probably benign Het
Uap1 C A 1: 169,971,000 (GRCm39) C464F probably damaging Het
Ugt2b36 A T 5: 87,240,087 (GRCm39) Y99* probably null Het
Usp35 T C 7: 96,975,134 (GRCm39) Y13C probably damaging Het
Vmn1r6 T G 6: 56,979,789 (GRCm39) N128K probably damaging Het
Vmn2r106 T A 17: 20,497,788 (GRCm39) I484L probably benign Het
Zdhhc4 A G 5: 143,311,915 (GRCm39) V19A probably benign Het
Zfp955b C T 17: 33,524,095 (GRCm39) probably benign Het
Zfp97 T A 17: 17,365,472 (GRCm39) C324S probably damaging Het
Zswim8 G A 14: 20,766,122 (GRCm39) D803N probably damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63,342,747 (GRCm39) missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63,342,397 (GRCm39) missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63,347,973 (GRCm39) missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63,348,031 (GRCm39) missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63,346,563 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7177:Zdbf2 UTSW 1 63,334,120 (GRCm39) missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8306:Zdbf2 UTSW 1 63,343,234 (GRCm39) missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63,347,168 (GRCm39) missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63,345,400 (GRCm39) missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCACTCTGACATTGACCCAC -3'
(R):5'- AAGTCACCAGTGTCTCCAAC -3'

Sequencing Primer
(F):5'- TGACATTGACCCACCTCAACCTAAG -3'
(R):5'- AAGTCACCAGTGTCTCCAACTTTAC -3'
Posted On 2016-08-04