Mutagenetix > Incidental Mutation

Incidental Mutation 'R5341:Zdbf2'

422305

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

042920-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R5341 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63307933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1824 (S1824T)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

probably benign
Transcript: ENSMUST00000029025
AA Change: S1824T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: S1824T

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114132
AA Change: S1824T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: S1824T

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Meta Mutation Damage Score

0.1067

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.2%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	C	19: 11,110,381		probably benign	Het
4931428F04Rik	A	T	8: 105,285,055	M226K	probably damaging	Het
Actr5	C	A	2: 158,625,224	S28*	probably null	Het
Adcy1	A	C	11: 7,130,375	M373L	probably damaging	Het
Adcyap1r1	C	G	6: 55,478,069	F111L	probably benign	Het
Arid5b	A	T	10: 68,278,127	F27I	possibly damaging	Het
Art5	C	A	7: 102,098,099	V158L	probably benign	Het
BC005561	A	T	5: 104,518,076	T155S	probably damaging	Het
Bora	T	A	14: 99,068,094	Y300N	probably damaging	Het
Btbd11	A	G	10: 85,387,372	D15G	unknown	Het
Ccdc84	A	G	9: 44,417,109		probably null	Het
Cd300a	A	G	11: 114,893,462	T99A	probably damaging	Het
Cdon	A	G	9: 35,470,135	Y607C	probably damaging	Het
Cpxm2	T	A	7: 132,154,613		probably benign	Het
Dhx8	AGACCGGGACCGGGACCGGGACCGGGAC	AGACCGGGACCGGGACCGGGAC	11: 101,738,190		probably benign	Het
Enox1	A	C	14: 77,577,656	T85P	possibly damaging	Het
Fanci	T	C	7: 79,406,178	L158P	probably damaging	Het
Gbgt1	C	A	2: 28,505,007	T219N	probably damaging	Het
Gm5689	A	G	18: 42,173,431	D21G	possibly damaging	Het
Gm9513	A	T	9: 36,477,061	K61*	probably null	Het
Gulo	T	C	14: 65,988,258	D373G	probably benign	Het
Hivep2	C	A	10: 14,132,592	Q1645K	possibly damaging	Het
Iqce	A	C	5: 140,690,059	M114R	possibly damaging	Het
Lmbrd1	A	T	1: 24,746,811	K396*	probably null	Het
Lrrk2	A	T	15: 91,772,858	D1785V	probably damaging	Het
Mcmdc2	ATAAAAAAAAAGGAAAAATTACCTT	AT	1: 9,940,917		probably null	Het
Mepce	A	G	5: 137,783,260	V564A	probably damaging	Het
Mmp17	A	T	5: 129,602,129	D364V	possibly damaging	Het
Mrgpre	T	C	7: 143,781,509	N86D	probably benign	Het
Olfr1276	T	A	2: 111,257,637	I174K	probably damaging	Het
Olfr458	A	T	6: 42,460,164	L285Q	probably damaging	Het
Pax5	T	C	4: 44,697,630	D35G	probably damaging	Het
Pip5k1b	T	A	19: 24,304,076	T473S	probably benign	Het
Pkd2l2	A	G	18: 34,409,934		probably null	Het
Pygo2	C	A	3: 89,432,760	P155Q	probably damaging	Het
Rb1cc1	G	T	1: 6,215,042		probably benign	Het
Rbpj	A	G	5: 53,642,083	E80G	possibly damaging	Het
Sbno1	A	C	5: 124,408,475		probably null	Het
Slc1a1	T	A	19: 28,897,568	V182E	probably benign	Het
Slc34a3	A	T	2: 25,230,659	F419I	probably benign	Het
Snx8	A	G	5: 140,358,131	V62A	probably damaging	Het
Sp9	T	C	2: 73,274,514	S471P	possibly damaging	Het
Sspo	A	T	6: 48,459,615	S1270C	probably damaging	Het
Stk11	A	T	10: 80,126,260	T83S	probably benign	Het
Syt13	A	G	2: 92,953,552	E389G	probably benign	Het
Taf10	T	C	7: 105,740,932		probably benign	Het
Tgm1	A	T	14: 55,700,248	S801R	possibly damaging	Het
Timeless	T	C	10: 128,247,178	F628L	possibly damaging	Het
Tmem171	G	T	13: 98,688,448	P225T	probably damaging	Het
Tspan12	A	T	6: 21,835,459	C72S	possibly damaging	Het
Txk	T	C	5: 72,696,621	T458A	probably benign	Het
Txndc9	A	G	1: 37,987,623		probably benign	Het
Uap1	C	A	1: 170,143,431	C464F	probably damaging	Het
Ugt2b36	A	T	5: 87,092,228	Y99*	probably null	Het
Usp35	T	C	7: 97,325,927	Y13C	probably damaging	Het
Vmn1r6	T	G	6: 57,002,804	N128K	probably damaging	Het
Vmn2r106	T	A	17: 20,277,526	I484L	probably benign	Het
Wdr60	T	C	12: 116,255,914	E136G	possibly damaging	Het
Zdhhc4	A	G	5: 143,326,160	V19A	probably benign	Het
Zfp955b	C	T	17: 33,305,121		probably benign	Het
Zfp97	T	A	17: 17,145,210	C324S	probably damaging	Het
Zswim8	G	A	14: 20,716,054	D803N	probably damaging	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCACTCTGACATTGACCCAC -3'
(R):5'- AAGTCACCAGTGTCTCCAAC -3'

Sequencing Primer
(F):5'- TGACATTGACCCACCTCAACCTAAG -3'
(R):5'- AAGTCACCAGTGTCTCCAACTTTAC -3'

Posted On

2016-08-04