Incidental Mutation 'R5341:Zdbf2'
ID422305
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Namezinc finger, DBF-type containing 2
Synonyms4930431J08Rik, 9330107J05Rik
MMRRC Submission 042920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5341 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63273265-63314576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63307933 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1824 (S1824T)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
Predicted Effect probably benign
Transcript: ENSMUST00000029025
AA Change: S1824T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: S1824T

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114132
AA Change: S1824T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: S1824T

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.1067 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,110,381 probably benign Het
4931428F04Rik A T 8: 105,285,055 M226K probably damaging Het
Actr5 C A 2: 158,625,224 S28* probably null Het
Adcy1 A C 11: 7,130,375 M373L probably damaging Het
Adcyap1r1 C G 6: 55,478,069 F111L probably benign Het
Arid5b A T 10: 68,278,127 F27I possibly damaging Het
Art5 C A 7: 102,098,099 V158L probably benign Het
BC005561 A T 5: 104,518,076 T155S probably damaging Het
Bora T A 14: 99,068,094 Y300N probably damaging Het
Btbd11 A G 10: 85,387,372 D15G unknown Het
Ccdc84 A G 9: 44,417,109 probably null Het
Cd300a A G 11: 114,893,462 T99A probably damaging Het
Cdon A G 9: 35,470,135 Y607C probably damaging Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Enox1 A C 14: 77,577,656 T85P possibly damaging Het
Fanci T C 7: 79,406,178 L158P probably damaging Het
Gbgt1 C A 2: 28,505,007 T219N probably damaging Het
Gm5689 A G 18: 42,173,431 D21G possibly damaging Het
Gm9513 A T 9: 36,477,061 K61* probably null Het
Gulo T C 14: 65,988,258 D373G probably benign Het
Hivep2 C A 10: 14,132,592 Q1645K possibly damaging Het
Iqce A C 5: 140,690,059 M114R possibly damaging Het
Lmbrd1 A T 1: 24,746,811 K396* probably null Het
Lrrk2 A T 15: 91,772,858 D1785V probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 9,940,917 probably null Het
Mepce A G 5: 137,783,260 V564A probably damaging Het
Mmp17 A T 5: 129,602,129 D364V possibly damaging Het
Mrgpre T C 7: 143,781,509 N86D probably benign Het
Olfr1276 T A 2: 111,257,637 I174K probably damaging Het
Olfr458 A T 6: 42,460,164 L285Q probably damaging Het
Pax5 T C 4: 44,697,630 D35G probably damaging Het
Pip5k1b T A 19: 24,304,076 T473S probably benign Het
Pkd2l2 A G 18: 34,409,934 probably null Het
Pygo2 C A 3: 89,432,760 P155Q probably damaging Het
Rb1cc1 G T 1: 6,215,042 probably benign Het
Rbpj A G 5: 53,642,083 E80G possibly damaging Het
Sbno1 A C 5: 124,408,475 probably null Het
Slc1a1 T A 19: 28,897,568 V182E probably benign Het
Slc34a3 A T 2: 25,230,659 F419I probably benign Het
Snx8 A G 5: 140,358,131 V62A probably damaging Het
Sp9 T C 2: 73,274,514 S471P possibly damaging Het
Sspo A T 6: 48,459,615 S1270C probably damaging Het
Stk11 A T 10: 80,126,260 T83S probably benign Het
Syt13 A G 2: 92,953,552 E389G probably benign Het
Taf10 T C 7: 105,740,932 probably benign Het
Tgm1 A T 14: 55,700,248 S801R possibly damaging Het
Timeless T C 10: 128,247,178 F628L possibly damaging Het
Tmem171 G T 13: 98,688,448 P225T probably damaging Het
Tspan12 A T 6: 21,835,459 C72S possibly damaging Het
Txk T C 5: 72,696,621 T458A probably benign Het
Txndc9 A G 1: 37,987,623 probably benign Het
Uap1 C A 1: 170,143,431 C464F probably damaging Het
Ugt2b36 A T 5: 87,092,228 Y99* probably null Het
Usp35 T C 7: 97,325,927 Y13C probably damaging Het
Vmn1r6 T G 6: 57,002,804 N128K probably damaging Het
Vmn2r106 T A 17: 20,277,526 I484L probably benign Het
Wdr60 T C 12: 116,255,914 E136G possibly damaging Het
Zdhhc4 A G 5: 143,326,160 V19A probably benign Het
Zfp955b C T 17: 33,305,121 probably benign Het
Zfp97 T A 17: 17,145,210 C324S probably damaging Het
Zswim8 G A 14: 20,716,054 D803N probably damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63306514 missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63307205 missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63303038 missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63303077 missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63308074 missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63304006 nonsense probably null
R0148:Zdbf2 UTSW 1 63304006 nonsense probably null
R0433:Zdbf2 UTSW 1 63306143 missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63305290 missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63304950 missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63305723 missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63303430 missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63303002 missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63303053 missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63303040 missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63303588 missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63303859 missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63304334 missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63308972 missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63304249 nonsense probably null
R1700:Zdbf2 UTSW 1 63302741 missense unknown
R1720:Zdbf2 UTSW 1 63303277 missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63305542 frame shift probably null
R1854:Zdbf2 UTSW 1 63305542 frame shift probably null
R1973:Zdbf2 UTSW 1 63309701 missense unknown
R2336:Zdbf2 UTSW 1 63303464 missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63305615 missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63303065 missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63304205 missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63307477 missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63308420 missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63308671 missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63308324 missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63309781 missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63302861 missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63308792 missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63303238 missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63308814 missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63303650 missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63304903 missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63304411 missense possibly damaging 0.66
R5511:Zdbf2 UTSW 1 63305677 missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63305876 missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63306526 missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63280818 start gained probably benign
R6245:Zdbf2 UTSW 1 63304433 missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63307822 missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63303321 missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63307478 missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63305520 missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63303914 missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63304508 missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63304520 missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63308528 missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63308872 missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63290766 missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63306766 missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63307404 missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63307559 missense probably benign
R7177:Zdbf2 UTSW 1 63294961 missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63306505 missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63303404 missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63304039 missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63307510 missense probably benign
R7695:Zdbf2 UTSW 1 63307370 missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63305371 missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63304105 missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63308007 nonsense probably null
R7759:Zdbf2 UTSW 1 63308376 missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63303424 missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
R7989:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
RF021:Zdbf2 UTSW 1 63302652 missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63305351 missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63308007 nonsense probably null
X0057:Zdbf2 UTSW 1 63305390 missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63305537 missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63304245 missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63304086 frame shift probably null
Z1177:Zdbf2 UTSW 1 63309203 missense unknown
Predicted Primers PCR Primer
(F):5'- TCACTCTGACATTGACCCAC -3'
(R):5'- AAGTCACCAGTGTCTCCAAC -3'

Sequencing Primer
(F):5'- TGACATTGACCCACCTCAACCTAAG -3'
(R):5'- AAGTCACCAGTGTCTCCAACTTTAC -3'
Posted On2016-08-04