Incidental Mutation 'R5341:Gbgt1'
ID422308
Institutional Source Beutler Lab
Gene Symbol Gbgt1
Ensembl Gene ENSMUSG00000026829
Gene Namegloboside alpha-1,3-N-acetylgalactosaminyltransferase 1
Synonyms
MMRRC Submission 042920-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5341 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28496891-28505415 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 28505007 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 219 (T219N)
Ref Sequence ENSEMBL: ENSMUSP00000127071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028172] [ENSMUST00000074761] [ENSMUST00000163121]
Predicted Effect probably damaging
Transcript: ENSMUST00000028172
AA Change: T219N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028172
Gene: ENSMUSG00000026829
AA Change: T219N

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Glyco_transf_6 33 347 1.6e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074761
SMART Domains Protein: ENSMUSP00000082978
Gene: ENSMUSG00000063611

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127958
Predicted Effect probably damaging
Transcript: ENSMUST00000163121
AA Change: T219N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127071
Gene: ENSMUSG00000026829
AA Change: T219N

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 11 347 1.9e-152 PFAM
Meta Mutation Damage Score 0.5785 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyltransferase that plays a role in the synthesis of Forssman glycolipid (FG), a member of the globoseries glycolipid family. Glycolipids such as FG form attachment sites for the binding of pathogens to cells; expression of this protein may determine host tropism to microorganisms. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,110,381 probably benign Het
4931428F04Rik A T 8: 105,285,055 M226K probably damaging Het
Actr5 C A 2: 158,625,224 S28* probably null Het
Adcy1 A C 11: 7,130,375 M373L probably damaging Het
Adcyap1r1 C G 6: 55,478,069 F111L probably benign Het
Arid5b A T 10: 68,278,127 F27I possibly damaging Het
Art5 C A 7: 102,098,099 V158L probably benign Het
BC005561 A T 5: 104,518,076 T155S probably damaging Het
Bora T A 14: 99,068,094 Y300N probably damaging Het
Btbd11 A G 10: 85,387,372 D15G unknown Het
Ccdc84 A G 9: 44,417,109 probably null Het
Cd300a A G 11: 114,893,462 T99A probably damaging Het
Cdon A G 9: 35,470,135 Y607C probably damaging Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Enox1 A C 14: 77,577,656 T85P possibly damaging Het
Fanci T C 7: 79,406,178 L158P probably damaging Het
Gm5689 A G 18: 42,173,431 D21G possibly damaging Het
Gm9513 A T 9: 36,477,061 K61* probably null Het
Gulo T C 14: 65,988,258 D373G probably benign Het
Hivep2 C A 10: 14,132,592 Q1645K possibly damaging Het
Iqce A C 5: 140,690,059 M114R possibly damaging Het
Lmbrd1 A T 1: 24,746,811 K396* probably null Het
Lrrk2 A T 15: 91,772,858 D1785V probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 9,940,917 probably null Het
Mepce A G 5: 137,783,260 V564A probably damaging Het
Mmp17 A T 5: 129,602,129 D364V possibly damaging Het
Mrgpre T C 7: 143,781,509 N86D probably benign Het
Olfr1276 T A 2: 111,257,637 I174K probably damaging Het
Olfr458 A T 6: 42,460,164 L285Q probably damaging Het
Pax5 T C 4: 44,697,630 D35G probably damaging Het
Pip5k1b T A 19: 24,304,076 T473S probably benign Het
Pkd2l2 A G 18: 34,409,934 probably null Het
Pygo2 C A 3: 89,432,760 P155Q probably damaging Het
Rb1cc1 G T 1: 6,215,042 probably benign Het
Rbpj A G 5: 53,642,083 E80G possibly damaging Het
Sbno1 A C 5: 124,408,475 probably null Het
Slc1a1 T A 19: 28,897,568 V182E probably benign Het
Slc34a3 A T 2: 25,230,659 F419I probably benign Het
Snx8 A G 5: 140,358,131 V62A probably damaging Het
Sp9 T C 2: 73,274,514 S471P possibly damaging Het
Sspo A T 6: 48,459,615 S1270C probably damaging Het
Stk11 A T 10: 80,126,260 T83S probably benign Het
Syt13 A G 2: 92,953,552 E389G probably benign Het
Taf10 T C 7: 105,740,932 probably benign Het
Tgm1 A T 14: 55,700,248 S801R possibly damaging Het
Timeless T C 10: 128,247,178 F628L possibly damaging Het
Tmem171 G T 13: 98,688,448 P225T probably damaging Het
Tspan12 A T 6: 21,835,459 C72S possibly damaging Het
Txk T C 5: 72,696,621 T458A probably benign Het
Txndc9 A G 1: 37,987,623 probably benign Het
Uap1 C A 1: 170,143,431 C464F probably damaging Het
Ugt2b36 A T 5: 87,092,228 Y99* probably null Het
Usp35 T C 7: 97,325,927 Y13C probably damaging Het
Vmn1r6 T G 6: 57,002,804 N128K probably damaging Het
Vmn2r106 T A 17: 20,277,526 I484L probably benign Het
Wdr60 T C 12: 116,255,914 E136G possibly damaging Het
Zdbf2 T A 1: 63,307,933 S1824T probably benign Het
Zdhhc4 A G 5: 143,326,160 V19A probably benign Het
Zfp955b C T 17: 33,305,121 probably benign Het
Zfp97 T A 17: 17,145,210 C324S probably damaging Het
Zswim8 G A 14: 20,716,054 D803N probably damaging Het
Other mutations in Gbgt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Gbgt1 APN 2 28502195 critical splice acceptor site probably null
IGL01586:Gbgt1 APN 2 28497830 missense probably benign 0.00
R0031:Gbgt1 UTSW 2 28498450 splice site probably benign
R0693:Gbgt1 UTSW 2 28504830 missense probably damaging 0.99
R1623:Gbgt1 UTSW 2 28504976 missense probably benign 0.38
R1739:Gbgt1 UTSW 2 28505052 missense possibly damaging 0.55
R2221:Gbgt1 UTSW 2 28498423 missense probably damaging 1.00
R4418:Gbgt1 UTSW 2 28498408 missense probably damaging 1.00
R4674:Gbgt1 UTSW 2 28498441 missense possibly damaging 0.87
R4675:Gbgt1 UTSW 2 28498441 missense possibly damaging 0.87
R4926:Gbgt1 UTSW 2 28503170 missense probably damaging 0.99
R5254:Gbgt1 UTSW 2 28505208 missense probably damaging 1.00
R5399:Gbgt1 UTSW 2 28503218 missense probably damaging 1.00
R6562:Gbgt1 UTSW 2 28504886 missense probably damaging 0.99
R6658:Gbgt1 UTSW 2 28504986 missense probably benign 0.00
R6830:Gbgt1 UTSW 2 28505208 missense probably damaging 1.00
R7466:Gbgt1 UTSW 2 28502207 missense probably damaging 0.96
R7636:Gbgt1 UTSW 2 28505314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATCCTACAGCCGTTCCCAG -3'
(R):5'- AGCTTTGTCTGCCAGAATGG -3'

Sequencing Primer
(F):5'- ACAGCCGTTCCCAGAGTTC -3'
(R):5'- GCAGGCCCGGGTAAACTC -3'
Posted On2016-08-04