Incidental Mutation 'R5341:Olfr1276'
ID422311
Institutional Source Beutler Lab
Gene Symbol Olfr1276
Ensembl Gene ENSMUSG00000063844
Gene Nameolfactory receptor 1276
SynonymsMOR245-10, GA_x6K02T2Q125-72308574-72309512
MMRRC Submission 042920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5341 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111254516-111262026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111257637 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 174 (I174K)
Ref Sequence ENSEMBL: ENSMUSP00000151987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073322] [ENSMUST00000218065]
Predicted Effect probably damaging
Transcript: ENSMUST00000073322
AA Change: I174K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073046
Gene: ENSMUSG00000063844
AA Change: I174K

DomainStartEndE-ValueType
Pfam:7tm_4 30 304 9.7e-40 PFAM
Pfam:7tm_1 41 287 4.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213658
Predicted Effect probably damaging
Transcript: ENSMUST00000218065
AA Change: I174K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,110,381 probably benign Het
4931428F04Rik A T 8: 105,285,055 M226K probably damaging Het
Actr5 C A 2: 158,625,224 S28* probably null Het
Adcy1 A C 11: 7,130,375 M373L probably damaging Het
Adcyap1r1 C G 6: 55,478,069 F111L probably benign Het
Arid5b A T 10: 68,278,127 F27I possibly damaging Het
Art5 C A 7: 102,098,099 V158L probably benign Het
BC005561 A T 5: 104,518,076 T155S probably damaging Het
Bora T A 14: 99,068,094 Y300N probably damaging Het
Btbd11 A G 10: 85,387,372 D15G unknown Het
Ccdc84 A G 9: 44,417,109 probably null Het
Cd300a A G 11: 114,893,462 T99A probably damaging Het
Cdon A G 9: 35,470,135 Y607C probably damaging Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Enox1 A C 14: 77,577,656 T85P possibly damaging Het
Fanci T C 7: 79,406,178 L158P probably damaging Het
Gbgt1 C A 2: 28,505,007 T219N probably damaging Het
Gm5689 A G 18: 42,173,431 D21G possibly damaging Het
Gm9513 A T 9: 36,477,061 K61* probably null Het
Gulo T C 14: 65,988,258 D373G probably benign Het
Hivep2 C A 10: 14,132,592 Q1645K possibly damaging Het
Iqce A C 5: 140,690,059 M114R possibly damaging Het
Lmbrd1 A T 1: 24,746,811 K396* probably null Het
Lrrk2 A T 15: 91,772,858 D1785V probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 9,940,917 probably null Het
Mepce A G 5: 137,783,260 V564A probably damaging Het
Mmp17 A T 5: 129,602,129 D364V possibly damaging Het
Mrgpre T C 7: 143,781,509 N86D probably benign Het
Olfr458 A T 6: 42,460,164 L285Q probably damaging Het
Pax5 T C 4: 44,697,630 D35G probably damaging Het
Pip5k1b T A 19: 24,304,076 T473S probably benign Het
Pkd2l2 A G 18: 34,409,934 probably null Het
Pygo2 C A 3: 89,432,760 P155Q probably damaging Het
Rb1cc1 G T 1: 6,215,042 probably benign Het
Rbpj A G 5: 53,642,083 E80G possibly damaging Het
Sbno1 A C 5: 124,408,475 probably null Het
Slc1a1 T A 19: 28,897,568 V182E probably benign Het
Slc34a3 A T 2: 25,230,659 F419I probably benign Het
Snx8 A G 5: 140,358,131 V62A probably damaging Het
Sp9 T C 2: 73,274,514 S471P possibly damaging Het
Sspo A T 6: 48,459,615 S1270C probably damaging Het
Stk11 A T 10: 80,126,260 T83S probably benign Het
Syt13 A G 2: 92,953,552 E389G probably benign Het
Taf10 T C 7: 105,740,932 probably benign Het
Tgm1 A T 14: 55,700,248 S801R possibly damaging Het
Timeless T C 10: 128,247,178 F628L possibly damaging Het
Tmem171 G T 13: 98,688,448 P225T probably damaging Het
Tspan12 A T 6: 21,835,459 C72S possibly damaging Het
Txk T C 5: 72,696,621 T458A probably benign Het
Txndc9 A G 1: 37,987,623 probably benign Het
Uap1 C A 1: 170,143,431 C464F probably damaging Het
Ugt2b36 A T 5: 87,092,228 Y99* probably null Het
Usp35 T C 7: 97,325,927 Y13C probably damaging Het
Vmn1r6 T G 6: 57,002,804 N128K probably damaging Het
Vmn2r106 T A 17: 20,277,526 I484L probably benign Het
Wdr60 T C 12: 116,255,914 E136G possibly damaging Het
Zdbf2 T A 1: 63,307,933 S1824T probably benign Het
Zdhhc4 A G 5: 143,326,160 V19A probably benign Het
Zfp955b C T 17: 33,305,121 probably benign Het
Zfp97 T A 17: 17,145,210 C324S probably damaging Het
Zswim8 G A 14: 20,716,054 D803N probably damaging Het
Other mutations in Olfr1276
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02339:Olfr1276 APN 2 111257243 missense probably benign 0.00
IGL03298:Olfr1276 APN 2 111257534 missense probably benign
R0022:Olfr1276 UTSW 2 111257649 missense probably benign 0.30
R0254:Olfr1276 UTSW 2 111257121 missense probably benign 0.13
R3903:Olfr1276 UTSW 2 111257769 missense probably damaging 1.00
R4801:Olfr1276 UTSW 2 111257152 missense probably damaging 1.00
R4802:Olfr1276 UTSW 2 111257152 missense probably damaging 1.00
R5165:Olfr1276 UTSW 2 111257223 missense possibly damaging 0.83
R5619:Olfr1276 UTSW 2 111257511 missense probably damaging 1.00
R7761:Olfr1276 UTSW 2 111257174 missense possibly damaging 0.93
R8181:Olfr1276 UTSW 2 111257573 missense probably benign
Z1088:Olfr1276 UTSW 2 111257859 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TATTGCTGGTAGCCATGGCC -3'
(R):5'- AACTACCACGGAGATGTGAGC -3'

Sequencing Primer
(F):5'- TAGCCATGGCCTGGGAC -3'
(R):5'- GGCCTTGGACAAATCTCCTGATG -3'
Posted On2016-08-04