Incidental Mutation 'R5341:Actr5'
Institutional Source Beutler Lab
Gene Symbol Actr5
Ensembl Gene ENSMUSG00000037761
Gene NameARP5 actin-related protein 5
MMRRC Submission 042920-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5341 (G1)
Quality Score104
Status Validated
Chromosomal Location158624888-158639211 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 158625224 bp
Amino Acid Change Serine to Stop codon at position 28 (S28*)
Ref Sequence ENSEMBL: ENSMUSP00000139110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045644] [ENSMUST00000183731]
Predicted Effect probably null
Transcript: ENSMUST00000045644
AA Change: S28*
SMART Domains Protein: ENSMUSP00000046658
Gene: ENSMUSG00000037761
AA Change: S28*

ACTIN 30 571 1.15e-36 SMART
low complexity region 593 605 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142531
Predicted Effect probably null
Transcript: ENSMUST00000183731
AA Change: S28*
SMART Domains Protein: ENSMUSP00000139110
Gene: ENSMUSG00000037761
AA Change: S28*

ACTIN 30 399 3.1e-8 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,110,381 probably benign Het
4931428F04Rik A T 8: 105,285,055 M226K probably damaging Het
Adcy1 A C 11: 7,130,375 M373L probably damaging Het
Adcyap1r1 C G 6: 55,478,069 F111L probably benign Het
Arid5b A T 10: 68,278,127 F27I possibly damaging Het
Art5 C A 7: 102,098,099 V158L probably benign Het
BC005561 A T 5: 104,518,076 T155S probably damaging Het
Bora T A 14: 99,068,094 Y300N probably damaging Het
Btbd11 A G 10: 85,387,372 D15G unknown Het
Ccdc84 A G 9: 44,417,109 probably null Het
Cd300a A G 11: 114,893,462 T99A probably damaging Het
Cdon A G 9: 35,470,135 Y607C probably damaging Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Enox1 A C 14: 77,577,656 T85P possibly damaging Het
Fanci T C 7: 79,406,178 L158P probably damaging Het
Gbgt1 C A 2: 28,505,007 T219N probably damaging Het
Gm5689 A G 18: 42,173,431 D21G possibly damaging Het
Gm9513 A T 9: 36,477,061 K61* probably null Het
Gulo T C 14: 65,988,258 D373G probably benign Het
Hivep2 C A 10: 14,132,592 Q1645K possibly damaging Het
Iqce A C 5: 140,690,059 M114R possibly damaging Het
Lmbrd1 A T 1: 24,746,811 K396* probably null Het
Lrrk2 A T 15: 91,772,858 D1785V probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 9,940,917 probably null Het
Mepce A G 5: 137,783,260 V564A probably damaging Het
Mmp17 A T 5: 129,602,129 D364V possibly damaging Het
Mrgpre T C 7: 143,781,509 N86D probably benign Het
Olfr1276 T A 2: 111,257,637 I174K probably damaging Het
Olfr458 A T 6: 42,460,164 L285Q probably damaging Het
Pax5 T C 4: 44,697,630 D35G probably damaging Het
Pip5k1b T A 19: 24,304,076 T473S probably benign Het
Pkd2l2 A G 18: 34,409,934 probably null Het
Pygo2 C A 3: 89,432,760 P155Q probably damaging Het
Rb1cc1 G T 1: 6,215,042 probably benign Het
Rbpj A G 5: 53,642,083 E80G possibly damaging Het
Sbno1 A C 5: 124,408,475 probably null Het
Slc1a1 T A 19: 28,897,568 V182E probably benign Het
Slc34a3 A T 2: 25,230,659 F419I probably benign Het
Snx8 A G 5: 140,358,131 V62A probably damaging Het
Sp9 T C 2: 73,274,514 S471P possibly damaging Het
Sspo A T 6: 48,459,615 S1270C probably damaging Het
Stk11 A T 10: 80,126,260 T83S probably benign Het
Syt13 A G 2: 92,953,552 E389G probably benign Het
Taf10 T C 7: 105,740,932 probably benign Het
Tgm1 A T 14: 55,700,248 S801R possibly damaging Het
Timeless T C 10: 128,247,178 F628L possibly damaging Het
Tmem171 G T 13: 98,688,448 P225T probably damaging Het
Tspan12 A T 6: 21,835,459 C72S possibly damaging Het
Txk T C 5: 72,696,621 T458A probably benign Het
Txndc9 A G 1: 37,987,623 probably benign Het
Uap1 C A 1: 170,143,431 C464F probably damaging Het
Ugt2b36 A T 5: 87,092,228 Y99* probably null Het
Usp35 T C 7: 97,325,927 Y13C probably damaging Het
Vmn1r6 T G 6: 57,002,804 N128K probably damaging Het
Vmn2r106 T A 17: 20,277,526 I484L probably benign Het
Wdr60 T C 12: 116,255,914 E136G possibly damaging Het
Zdbf2 T A 1: 63,307,933 S1824T probably benign Het
Zdhhc4 A G 5: 143,326,160 V19A probably benign Het
Zfp955b C T 17: 33,305,121 probably benign Het
Zfp97 T A 17: 17,145,210 C324S probably damaging Het
Zswim8 G A 14: 20,716,054 D803N probably damaging Het
Other mutations in Actr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Actr5 APN 2 158636802 critical splice donor site probably null
IGL02622:Actr5 APN 2 158638808 missense probably benign 0.03
IGL02707:Actr5 APN 2 158636697 missense probably benign 0.45
R0610:Actr5 UTSW 2 158632456 critical splice donor site probably null
R1467:Actr5 UTSW 2 158638697 missense probably benign 0.02
R1467:Actr5 UTSW 2 158638697 missense probably benign 0.02
R1720:Actr5 UTSW 2 158636137 missense possibly damaging 0.93
R1869:Actr5 UTSW 2 158638723 missense probably damaging 0.99
R1937:Actr5 UTSW 2 158636029 missense possibly damaging 0.63
R2051:Actr5 UTSW 2 158632293 missense probably benign 0.00
R2389:Actr5 UTSW 2 158625212 missense probably benign
R2420:Actr5 UTSW 2 158636081 missense probably damaging 1.00
R2422:Actr5 UTSW 2 158636081 missense probably damaging 1.00
R2909:Actr5 UTSW 2 158625220 missense possibly damaging 0.52
R4089:Actr5 UTSW 2 158625102 utr 5 prime probably benign
R4719:Actr5 UTSW 2 158626513 missense probably damaging 0.97
R4737:Actr5 UTSW 2 158628071 missense probably damaging 1.00
R4820:Actr5 UTSW 2 158625506 missense probably damaging 1.00
R5010:Actr5 UTSW 2 158635363 missense probably benign 0.00
R5457:Actr5 UTSW 2 158635998 splice site probably null
R6328:Actr5 UTSW 2 158635344 missense possibly damaging 0.72
R7158:Actr5 UTSW 2 158626414 missense possibly damaging 0.95
Z1177:Actr5 UTSW 2 158636705 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-08-04