Incidental Mutation 'R5341:Art5'
Institutional Source Beutler Lab
Gene Symbol Art5
Ensembl Gene ENSMUSG00000070424
Gene NameADP-ribosyltransferase 5
MMRRC Submission 042920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5341 (G1)
Quality Score225
Status Validated
Chromosomal Location102096879-102109489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 102098099 bp
Amino Acid Change Valine to Leucine at position 158 (V158L)
Ref Sequence ENSEMBL: ENSMUSP00000102550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033300] [ENSMUST00000084843] [ENSMUST00000094128] [ENSMUST00000106934] [ENSMUST00000106935] [ENSMUST00000106937] [ENSMUST00000123372] [ENSMUST00000124189] [ENSMUST00000139104] [ENSMUST00000209809] [ENSMUST00000210211]
Predicted Effect probably benign
Transcript: ENSMUST00000033300
SMART Domains Protein: ENSMUSP00000033300
Gene: ENSMUSG00000030996

signal peptide 1 19 N/A INTRINSIC
Pfam:ART 39 269 2e-99 PFAM
low complexity region 288 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084843
SMART Domains Protein: ENSMUSP00000081903
Gene: ENSMUSG00000070425

Pfam:XRCC1_N 1 150 1.4e-54 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 1e-24 PFAM
Pfam:Ion_trans 716 1024 1.7e-24 PFAM
Pfam:PKD_channel 774 1019 2.4e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094128
AA Change: V158L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000091678
Gene: ENSMUSG00000070424
AA Change: V158L

signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 3.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106934
SMART Domains Protein: ENSMUSP00000102547
Gene: ENSMUSG00000070424

signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 117 3.7e-29 PFAM
Pfam:ART 114 157 6.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106935
SMART Domains Protein: ENSMUSP00000102548
Gene: ENSMUSG00000070424

signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 146 2.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106937
AA Change: V158L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102550
Gene: ENSMUSG00000070424
AA Change: V158L

signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 1.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123372
SMART Domains Protein: ENSMUSP00000121068
Gene: ENSMUSG00000070425

Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000124189
SMART Domains Protein: ENSMUSP00000116934
Gene: ENSMUSG00000100254

low complexity region 29 41 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
ANK 65 95 1.58e3 SMART
low complexity region 110 122 N/A INTRINSIC
ANK 148 177 1.74e0 SMART
Pfam:TRP_2 183 245 9.1e-29 PFAM
transmembrane domain 345 367 N/A INTRINSIC
Pfam:PKD_channel 398 645 1.4e-12 PFAM
Pfam:Ion_trans 422 638 1e-31 PFAM
low complexity region 696 707 N/A INTRINSIC
low complexity region 719 730 N/A INTRINSIC
coiled coil region 748 788 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139104
SMART Domains Protein: ENSMUSP00000122430
Gene: ENSMUSG00000070425

Pfam:XRCC1_N 1 62 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155078
SMART Domains Protein: ENSMUSP00000123466
Gene: ENSMUSG00000070425

Pfam:XRCC1_N 1 62 4.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209809
Predicted Effect probably benign
Transcript: ENSMUST00000210211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211553
Meta Mutation Damage Score 0.2919 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,110,381 probably benign Het
4931428F04Rik A T 8: 105,285,055 M226K probably damaging Het
Actr5 C A 2: 158,625,224 S28* probably null Het
Adcy1 A C 11: 7,130,375 M373L probably damaging Het
Adcyap1r1 C G 6: 55,478,069 F111L probably benign Het
Arid5b A T 10: 68,278,127 F27I possibly damaging Het
BC005561 A T 5: 104,518,076 T155S probably damaging Het
Bora T A 14: 99,068,094 Y300N probably damaging Het
Btbd11 A G 10: 85,387,372 D15G unknown Het
Ccdc84 A G 9: 44,417,109 probably null Het
Cd300a A G 11: 114,893,462 T99A probably damaging Het
Cdon A G 9: 35,470,135 Y607C probably damaging Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Enox1 A C 14: 77,577,656 T85P possibly damaging Het
Fanci T C 7: 79,406,178 L158P probably damaging Het
Gbgt1 C A 2: 28,505,007 T219N probably damaging Het
Gm5689 A G 18: 42,173,431 D21G possibly damaging Het
Gm9513 A T 9: 36,477,061 K61* probably null Het
Gulo T C 14: 65,988,258 D373G probably benign Het
Hivep2 C A 10: 14,132,592 Q1645K possibly damaging Het
Iqce A C 5: 140,690,059 M114R possibly damaging Het
Lmbrd1 A T 1: 24,746,811 K396* probably null Het
Lrrk2 A T 15: 91,772,858 D1785V probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 9,940,917 probably null Het
Mepce A G 5: 137,783,260 V564A probably damaging Het
Mmp17 A T 5: 129,602,129 D364V possibly damaging Het
Mrgpre T C 7: 143,781,509 N86D probably benign Het
Olfr1276 T A 2: 111,257,637 I174K probably damaging Het
Olfr458 A T 6: 42,460,164 L285Q probably damaging Het
Pax5 T C 4: 44,697,630 D35G probably damaging Het
Pip5k1b T A 19: 24,304,076 T473S probably benign Het
Pkd2l2 A G 18: 34,409,934 probably null Het
Pygo2 C A 3: 89,432,760 P155Q probably damaging Het
Rb1cc1 G T 1: 6,215,042 probably benign Het
Rbpj A G 5: 53,642,083 E80G possibly damaging Het
Sbno1 A C 5: 124,408,475 probably null Het
Slc1a1 T A 19: 28,897,568 V182E probably benign Het
Slc34a3 A T 2: 25,230,659 F419I probably benign Het
Snx8 A G 5: 140,358,131 V62A probably damaging Het
Sp9 T C 2: 73,274,514 S471P possibly damaging Het
Sspo A T 6: 48,459,615 S1270C probably damaging Het
Stk11 A T 10: 80,126,260 T83S probably benign Het
Syt13 A G 2: 92,953,552 E389G probably benign Het
Taf10 T C 7: 105,740,932 probably benign Het
Tgm1 A T 14: 55,700,248 S801R possibly damaging Het
Timeless T C 10: 128,247,178 F628L possibly damaging Het
Tmem171 G T 13: 98,688,448 P225T probably damaging Het
Tspan12 A T 6: 21,835,459 C72S possibly damaging Het
Txk T C 5: 72,696,621 T458A probably benign Het
Txndc9 A G 1: 37,987,623 probably benign Het
Uap1 C A 1: 170,143,431 C464F probably damaging Het
Ugt2b36 A T 5: 87,092,228 Y99* probably null Het
Usp35 T C 7: 97,325,927 Y13C probably damaging Het
Vmn1r6 T G 6: 57,002,804 N128K probably damaging Het
Vmn2r106 T A 17: 20,277,526 I484L probably benign Het
Wdr60 T C 12: 116,255,914 E136G possibly damaging Het
Zdbf2 T A 1: 63,307,933 S1824T probably benign Het
Zdhhc4 A G 5: 143,326,160 V19A probably benign Het
Zfp955b C T 17: 33,305,121 probably benign Het
Zfp97 T A 17: 17,145,210 C324S probably damaging Het
Zswim8 G A 14: 20,716,054 D803N probably damaging Het
Other mutations in Art5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Art5 APN 7 102097916 missense probably null
IGL02507:Art5 APN 7 102099492 start codon destroyed probably null 0.83
IGL03143:Art5 APN 7 102097897 missense probably damaging 1.00
Buonarotti UTSW 7 102098170 missense probably damaging 1.00
R0632:Art5 UTSW 7 102097957 missense probably damaging 1.00
R1215:Art5 UTSW 7 102097909 missense probably damaging 0.99
R2151:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R2152:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R2153:Art5 UTSW 7 102098200 missense possibly damaging 0.71
R4533:Art5 UTSW 7 102098338 missense probably benign
R4719:Art5 UTSW 7 102098494 splice site probably null
R5042:Art5 UTSW 7 102099465 missense probably damaging 0.99
R5098:Art5 UTSW 7 102097970 missense probably damaging 0.98
R6037:Art5 UTSW 7 102098384 missense probably benign 0.01
R6037:Art5 UTSW 7 102098384 missense probably benign 0.01
R6262:Art5 UTSW 7 102098131 missense probably benign 0.00
R6850:Art5 UTSW 7 102098095 missense possibly damaging 0.60
R7186:Art5 UTSW 7 102097329 missense probably benign
R7270:Art5 UTSW 7 102097873 missense probably damaging 1.00
R7381:Art5 UTSW 7 102098170 missense probably damaging 1.00
R7729:Art5 UTSW 7 102098504 missense possibly damaging 0.51
R8061:Art5 UTSW 7 102098249 missense possibly damaging 0.92
R8112:Art5 UTSW 7 102098011 missense probably benign
X0061:Art5 UTSW 7 102098380 missense probably benign 0.21
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-08-04