Incidental Mutation 'R5341:Timeless'
ID422344
Institutional Source Beutler Lab
Gene Symbol Timeless
Ensembl Gene ENSMUSG00000039994
Gene Nametimeless circadian clock 1
Synonymstim
MMRRC Submission 042920-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5341 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128232065-128252941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128247178 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 628 (F628L)
Ref Sequence ENSEMBL: ENSMUSP00000100879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000105242] [ENSMUST00000105243] [ENSMUST00000105244] [ENSMUST00000105245]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055539
AA Change: F628L

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994
AA Change: F628L

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.2e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105240
Predicted Effect possibly damaging
Transcript: ENSMUST00000105242
AA Change: F628L

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994
AA Change: F628L

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.1e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 4.4e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105243
SMART Domains Protein: ENSMUSP00000100877
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 7.8e-104 PFAM
low complexity region 381 395 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105244
AA Change: F628L

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994
AA Change: F628L

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.3e-103 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 5e-187 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105245
AA Change: F628L

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994
AA Change: F628L

DomainStartEndE-ValueType
Pfam:TIMELESS 24 284 1.1e-81 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146945
Meta Mutation Damage Score 0.3197 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: The protein encoded by this gene is highly conserved and is involved in cell survival after damage or stress, increase in DNA polymerase epsilon activity, maintenance of telomere length, and epithelial cell morphogenesis. The encoded protein also plays a role in the circadian rhythm autoregulatory loop, interacting with the PERIOD genes (PER1, PER2, and PER3) and others to downregulate activation of PER1 by CLOCK/ARNTL. Changes in this gene or its expression may promote prostate cancer, lung cancer, breast cancer, and mental disorders. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit early embryonic lethality at aprroximately the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,110,381 probably benign Het
4931428F04Rik A T 8: 105,285,055 M226K probably damaging Het
Actr5 C A 2: 158,625,224 S28* probably null Het
Adcy1 A C 11: 7,130,375 M373L probably damaging Het
Adcyap1r1 C G 6: 55,478,069 F111L probably benign Het
Arid5b A T 10: 68,278,127 F27I possibly damaging Het
Art5 C A 7: 102,098,099 V158L probably benign Het
BC005561 A T 5: 104,518,076 T155S probably damaging Het
Bora T A 14: 99,068,094 Y300N probably damaging Het
Btbd11 A G 10: 85,387,372 D15G unknown Het
Ccdc84 A G 9: 44,417,109 probably null Het
Cd300a A G 11: 114,893,462 T99A probably damaging Het
Cdon A G 9: 35,470,135 Y607C probably damaging Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Enox1 A C 14: 77,577,656 T85P possibly damaging Het
Fanci T C 7: 79,406,178 L158P probably damaging Het
Gbgt1 C A 2: 28,505,007 T219N probably damaging Het
Gm5689 A G 18: 42,173,431 D21G possibly damaging Het
Gm9513 A T 9: 36,477,061 K61* probably null Het
Gulo T C 14: 65,988,258 D373G probably benign Het
Hivep2 C A 10: 14,132,592 Q1645K possibly damaging Het
Iqce A C 5: 140,690,059 M114R possibly damaging Het
Lmbrd1 A T 1: 24,746,811 K396* probably null Het
Lrrk2 A T 15: 91,772,858 D1785V probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 9,940,917 probably null Het
Mepce A G 5: 137,783,260 V564A probably damaging Het
Mmp17 A T 5: 129,602,129 D364V possibly damaging Het
Mrgpre T C 7: 143,781,509 N86D probably benign Het
Olfr1276 T A 2: 111,257,637 I174K probably damaging Het
Olfr458 A T 6: 42,460,164 L285Q probably damaging Het
Pax5 T C 4: 44,697,630 D35G probably damaging Het
Pip5k1b T A 19: 24,304,076 T473S probably benign Het
Pkd2l2 A G 18: 34,409,934 probably null Het
Pygo2 C A 3: 89,432,760 P155Q probably damaging Het
Rb1cc1 G T 1: 6,215,042 probably benign Het
Rbpj A G 5: 53,642,083 E80G possibly damaging Het
Sbno1 A C 5: 124,408,475 probably null Het
Slc1a1 T A 19: 28,897,568 V182E probably benign Het
Slc34a3 A T 2: 25,230,659 F419I probably benign Het
Snx8 A G 5: 140,358,131 V62A probably damaging Het
Sp9 T C 2: 73,274,514 S471P possibly damaging Het
Sspo A T 6: 48,459,615 S1270C probably damaging Het
Stk11 A T 10: 80,126,260 T83S probably benign Het
Syt13 A G 2: 92,953,552 E389G probably benign Het
Taf10 T C 7: 105,740,932 probably benign Het
Tgm1 A T 14: 55,700,248 S801R possibly damaging Het
Tmem171 G T 13: 98,688,448 P225T probably damaging Het
Tspan12 A T 6: 21,835,459 C72S possibly damaging Het
Txk T C 5: 72,696,621 T458A probably benign Het
Txndc9 A G 1: 37,987,623 probably benign Het
Uap1 C A 1: 170,143,431 C464F probably damaging Het
Ugt2b36 A T 5: 87,092,228 Y99* probably null Het
Usp35 T C 7: 97,325,927 Y13C probably damaging Het
Vmn1r6 T G 6: 57,002,804 N128K probably damaging Het
Vmn2r106 T A 17: 20,277,526 I484L probably benign Het
Wdr60 T C 12: 116,255,914 E136G possibly damaging Het
Zdbf2 T A 1: 63,307,933 S1824T probably benign Het
Zdhhc4 A G 5: 143,326,160 V19A probably benign Het
Zfp955b C T 17: 33,305,121 probably benign Het
Zfp97 T A 17: 17,145,210 C324S probably damaging Het
Zswim8 G A 14: 20,716,054 D803N probably damaging Het
Other mutations in Timeless
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Timeless APN 10 128241708 missense probably damaging 1.00
IGL02157:Timeless APN 10 128242386 missense probably benign 0.01
IGL02300:Timeless APN 10 128244807 missense probably benign 0.00
IGL02587:Timeless APN 10 128239916 missense probably damaging 0.99
IGL02588:Timeless APN 10 128243334 missense probably damaging 1.00
IGL02892:Timeless APN 10 128244251 missense probably damaging 1.00
IGL02930:Timeless APN 10 128247191 missense probably benign 0.00
IGL02986:Timeless APN 10 128249760 missense possibly damaging 0.82
IGL03345:Timeless APN 10 128247586 missense probably benign 0.04
IGL03393:Timeless APN 10 128252055 missense probably damaging 1.00
R0388:Timeless UTSW 10 128241425 splice site probably null
R0607:Timeless UTSW 10 128246334 missense probably benign
R0638:Timeless UTSW 10 128244673 nonsense probably null
R0734:Timeless UTSW 10 128250060 missense probably damaging 1.00
R1346:Timeless UTSW 10 128242365 missense possibly damaging 0.83
R1625:Timeless UTSW 10 128240624 missense probably damaging 0.99
R1771:Timeless UTSW 10 128247608 missense probably benign 0.11
R1860:Timeless UTSW 10 128246114 missense probably benign 0.00
R1920:Timeless UTSW 10 128241714 missense probably damaging 1.00
R1988:Timeless UTSW 10 128244187 missense probably damaging 0.98
R2981:Timeless UTSW 10 128248458 missense probably benign 0.34
R4359:Timeless UTSW 10 128247342 missense probably benign 0.00
R4647:Timeless UTSW 10 128239956 missense possibly damaging 0.80
R4753:Timeless UTSW 10 128240020 utr 5 prime probably benign
R4868:Timeless UTSW 10 128247361 missense probably benign
R4901:Timeless UTSW 10 128250762 missense probably damaging 1.00
R4956:Timeless UTSW 10 128241651 missense probably damaging 1.00
R5439:Timeless UTSW 10 128241735 missense probably damaging 1.00
R5585:Timeless UTSW 10 128240243 missense probably damaging 0.97
R5842:Timeless UTSW 10 128247459 critical splice donor site probably null
R5843:Timeless UTSW 10 128244244 splice site probably null
R6005:Timeless UTSW 10 128244200 missense probably damaging 0.99
R6271:Timeless UTSW 10 128250724 missense probably damaging 1.00
R6558:Timeless UTSW 10 128249563 missense probably benign 0.01
R6694:Timeless UTSW 10 128239999 critical splice donor site probably null
R6738:Timeless UTSW 10 128240635 missense probably damaging 1.00
R6760:Timeless UTSW 10 128246117 missense probably benign 0.38
R7213:Timeless UTSW 10 128243289 missense probably benign
R7248:Timeless UTSW 10 128252001 missense probably benign
R7345:Timeless UTSW 10 128249754 missense probably damaging 1.00
R7463:Timeless UTSW 10 128250426 missense probably benign 0.00
R7513:Timeless UTSW 10 128249530 missense probably damaging 0.99
R7574:Timeless UTSW 10 128244669 missense probably damaging 1.00
R8220:Timeless UTSW 10 128246396 missense probably damaging 0.98
R8418:Timeless UTSW 10 128250736 missense not run
X0028:Timeless UTSW 10 128250325 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGTATAGATGCAGGTCAGAC -3'
(R):5'- TTCTCTGACACCTGGACCAC -3'

Sequencing Primer
(F):5'- AGCTCAGGTCTTCTGCAAGAG -3'
(R):5'- TGACACCTGGACCACCTGTAAC -3'
Posted On2016-08-04