Incidental Mutation 'R5341:Adcy1'
ID422345
Institutional Source Beutler Lab
Gene Symbol Adcy1
Ensembl Gene ENSMUSG00000020431
Gene Nameadenylate cyclase 1
SynonymsI-AC, D11Bwg1392e, AC1
MMRRC Submission 042920-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5341 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location7063489-7178506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 7130375 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 373 (M373L)
Ref Sequence ENSEMBL: ENSMUSP00000020706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020706]
Predicted Effect probably damaging
Transcript: ENSMUST00000020706
AA Change: M373L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020706
Gene: ENSMUSG00000020431
AA Change: M373L

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
low complexity region 58 90 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
CYCc 257 455 2.05e-80 SMART
transmembrane domain 608 630 N/A INTRINSIC
transmembrane domain 634 656 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
CYCc 827 1038 1.71e-50 SMART
low complexity region 1090 1104 N/A INTRINSIC
Meta Mutation Damage Score 0.2706 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the of adenylate cyclase gene family that is primarily expressed in the brain. This protein is regulated by calcium/calmodulin concentration and may be involved in brain development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for an insertional or null mutation fail to develop normal patterned distribution of neurons in the brain and display behavioral and learning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,110,381 probably benign Het
4931428F04Rik A T 8: 105,285,055 M226K probably damaging Het
Actr5 C A 2: 158,625,224 S28* probably null Het
Adcyap1r1 C G 6: 55,478,069 F111L probably benign Het
Arid5b A T 10: 68,278,127 F27I possibly damaging Het
Art5 C A 7: 102,098,099 V158L probably benign Het
BC005561 A T 5: 104,518,076 T155S probably damaging Het
Bora T A 14: 99,068,094 Y300N probably damaging Het
Btbd11 A G 10: 85,387,372 D15G unknown Het
Ccdc84 A G 9: 44,417,109 probably null Het
Cd300a A G 11: 114,893,462 T99A probably damaging Het
Cdon A G 9: 35,470,135 Y607C probably damaging Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Enox1 A C 14: 77,577,656 T85P possibly damaging Het
Fanci T C 7: 79,406,178 L158P probably damaging Het
Gbgt1 C A 2: 28,505,007 T219N probably damaging Het
Gm5689 A G 18: 42,173,431 D21G possibly damaging Het
Gm9513 A T 9: 36,477,061 K61* probably null Het
Gulo T C 14: 65,988,258 D373G probably benign Het
Hivep2 C A 10: 14,132,592 Q1645K possibly damaging Het
Iqce A C 5: 140,690,059 M114R possibly damaging Het
Lmbrd1 A T 1: 24,746,811 K396* probably null Het
Lrrk2 A T 15: 91,772,858 D1785V probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 9,940,917 probably null Het
Mepce A G 5: 137,783,260 V564A probably damaging Het
Mmp17 A T 5: 129,602,129 D364V possibly damaging Het
Mrgpre T C 7: 143,781,509 N86D probably benign Het
Olfr1276 T A 2: 111,257,637 I174K probably damaging Het
Olfr458 A T 6: 42,460,164 L285Q probably damaging Het
Pax5 T C 4: 44,697,630 D35G probably damaging Het
Pip5k1b T A 19: 24,304,076 T473S probably benign Het
Pkd2l2 A G 18: 34,409,934 probably null Het
Pygo2 C A 3: 89,432,760 P155Q probably damaging Het
Rb1cc1 G T 1: 6,215,042 probably benign Het
Rbpj A G 5: 53,642,083 E80G possibly damaging Het
Sbno1 A C 5: 124,408,475 probably null Het
Slc1a1 T A 19: 28,897,568 V182E probably benign Het
Slc34a3 A T 2: 25,230,659 F419I probably benign Het
Snx8 A G 5: 140,358,131 V62A probably damaging Het
Sp9 T C 2: 73,274,514 S471P possibly damaging Het
Sspo A T 6: 48,459,615 S1270C probably damaging Het
Stk11 A T 10: 80,126,260 T83S probably benign Het
Syt13 A G 2: 92,953,552 E389G probably benign Het
Taf10 T C 7: 105,740,932 probably benign Het
Tgm1 A T 14: 55,700,248 S801R possibly damaging Het
Timeless T C 10: 128,247,178 F628L possibly damaging Het
Tmem171 G T 13: 98,688,448 P225T probably damaging Het
Tspan12 A T 6: 21,835,459 C72S possibly damaging Het
Txk T C 5: 72,696,621 T458A probably benign Het
Txndc9 A G 1: 37,987,623 probably benign Het
Uap1 C A 1: 170,143,431 C464F probably damaging Het
Ugt2b36 A T 5: 87,092,228 Y99* probably null Het
Usp35 T C 7: 97,325,927 Y13C probably damaging Het
Vmn1r6 T G 6: 57,002,804 N128K probably damaging Het
Vmn2r106 T A 17: 20,277,526 I484L probably benign Het
Wdr60 T C 12: 116,255,914 E136G possibly damaging Het
Zdbf2 T A 1: 63,307,933 S1824T probably benign Het
Zdhhc4 A G 5: 143,326,160 V19A probably benign Het
Zfp955b C T 17: 33,305,121 probably benign Het
Zfp97 T A 17: 17,145,210 C324S probably damaging Het
Zswim8 G A 14: 20,716,054 D803N probably damaging Het
Other mutations in Adcy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Adcy1 APN 11 7137385 missense probably damaging 0.99
IGL01325:Adcy1 APN 11 7064102 missense possibly damaging 0.58
IGL01531:Adcy1 APN 11 7169414 missense possibly damaging 0.95
IGL01585:Adcy1 APN 11 7167143 missense probably damaging 1.00
IGL01932:Adcy1 APN 11 7100565 splice site probably benign
IGL01945:Adcy1 APN 11 7161891 missense probably damaging 1.00
IGL02532:Adcy1 APN 11 7144737 missense probably benign 0.26
IGL02649:Adcy1 APN 11 7167156 missense probably damaging 1.00
IGL02658:Adcy1 APN 11 7138279 splice site probably benign
IGL02813:Adcy1 APN 11 7146591 missense possibly damaging 0.83
IGL02931:Adcy1 APN 11 7079012 missense probably benign 0.19
IGL03116:Adcy1 APN 11 7150071 missense probably benign
IGL03119:Adcy1 APN 11 7109051 missense probably damaging 1.00
IGL03214:Adcy1 APN 11 7167054 splice site probably benign
PIT4431001:Adcy1 UTSW 11 7064089 missense possibly damaging 0.93
PIT4520001:Adcy1 UTSW 11 7167133 missense probably damaging 1.00
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0080:Adcy1 UTSW 11 7149497 splice site probably benign
R0082:Adcy1 UTSW 11 7149497 splice site probably benign
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0312:Adcy1 UTSW 11 7149538 missense probably benign 0.08
R0569:Adcy1 UTSW 11 7146514 missense probably benign 0.34
R1055:Adcy1 UTSW 11 7109075 missense probably damaging 1.00
R1144:Adcy1 UTSW 11 7137400 missense probably damaging 1.00
R1179:Adcy1 UTSW 11 7167054 splice site probably null
R1245:Adcy1 UTSW 11 7169410 splice site probably benign
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1823:Adcy1 UTSW 11 7161312 missense probably benign 0.23
R1953:Adcy1 UTSW 11 7078991 missense probably benign 0.01
R1957:Adcy1 UTSW 11 7161945 missense probably benign 0.00
R2029:Adcy1 UTSW 11 7139142 missense probably benign 0.10
R2051:Adcy1 UTSW 11 7161885 nonsense probably null
R2483:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3108:Adcy1 UTSW 11 7169453 missense probably damaging 1.00
R3623:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3624:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R4082:Adcy1 UTSW 11 7064117 missense probably damaging 1.00
R4159:Adcy1 UTSW 11 7063889 missense probably damaging 1.00
R4470:Adcy1 UTSW 11 7144804 missense probably benign 0.17
R4472:Adcy1 UTSW 11 7130369 missense probably damaging 1.00
R4951:Adcy1 UTSW 11 7138336 missense possibly damaging 0.83
R4997:Adcy1 UTSW 11 7161298 missense probably benign 0.25
R5237:Adcy1 UTSW 11 7149553 missense probably benign 0.00
R5288:Adcy1 UTSW 11 7161351 missense probably benign 0.01
R5304:Adcy1 UTSW 11 7064198 missense probably benign 0.00
R5379:Adcy1 UTSW 11 7146532 missense probably damaging 1.00
R5592:Adcy1 UTSW 11 7139088 nonsense probably null
R5677:Adcy1 UTSW 11 7161914 missense probably damaging 1.00
R5680:Adcy1 UTSW 11 7109020 missense probably damaging 1.00
R5753:Adcy1 UTSW 11 7130300 missense probably damaging 1.00
R5888:Adcy1 UTSW 11 7139095 missense possibly damaging 0.66
R5943:Adcy1 UTSW 11 7161337 missense probably damaging 1.00
R6435:Adcy1 UTSW 11 7161367 missense possibly damaging 0.60
R6931:Adcy1 UTSW 11 7150884 missense possibly damaging 0.81
R6998:Adcy1 UTSW 11 7079026 missense probably damaging 1.00
R7368:Adcy1 UTSW 11 7144765 missense probably damaging 1.00
R7378:Adcy1 UTSW 11 7169543 missense possibly damaging 0.56
R7393:Adcy1 UTSW 11 7137381 missense probably damaging 1.00
R7500:Adcy1 UTSW 11 7144762 missense probably damaging 1.00
R7529:Adcy1 UTSW 11 7139157 missense probably damaging 0.98
X0027:Adcy1 UTSW 11 7161930 missense possibly damaging 0.47
Z1088:Adcy1 UTSW 11 7150019 missense probably benign 0.19
Z1176:Adcy1 UTSW 11 7109098 missense probably damaging 1.00
Z1176:Adcy1 UTSW 11 7149536 missense probably damaging 0.99
Z1176:Adcy1 UTSW 11 7150857 missense probably damaging 0.96
Z1176:Adcy1 UTSW 11 7150858 missense possibly damaging 0.62
Z1177:Adcy1 UTSW 11 7100642 nonsense probably null
Z1177:Adcy1 UTSW 11 7144802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGGAGATACCCATTTGAGC -3'
(R):5'- TCCCCTATCTCAGGCACACTAG -3'

Sequencing Primer
(F):5'- AGATACCCATTTGAGCCTGGC -3'
(R):5'- GATACACAAAGGATTTCTCTGGAC -3'
Posted On2016-08-04