Incidental Mutation 'R0485:Cacna2d3'
ID 42235
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms alpha 2 delta-3, alpha2delta3
MMRRC Submission 038684-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0485 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 28626900-29443821 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29256476 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 95 (M95L)
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567]
AlphaFold Q9Z1L5
Predicted Effect possibly damaging
Transcript: ENSMUST00000022567
AA Change: M95L

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991
AA Change: M95L

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Meta Mutation Damage Score 0.1519 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.4%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik A G 16: 3,725,511 (GRCm39) V5A probably damaging Het
Abi3bp A G 16: 56,424,375 (GRCm39) probably null Het
Acot11 G A 4: 106,619,224 (GRCm39) R184C probably damaging Het
Adgre5 A T 8: 84,458,627 (GRCm39) I133N probably damaging Het
Afap1 A T 5: 36,108,347 (GRCm39) Q231L probably damaging Het
Alg12 T C 15: 88,695,630 (GRCm39) T289A probably benign Het
Ank3 T A 10: 69,718,374 (GRCm39) S542T possibly damaging Het
Ankmy2 G A 12: 36,232,389 (GRCm39) R138Q possibly damaging Het
Ascc2 C T 11: 4,622,302 (GRCm39) A456V probably benign Het
Atg4c G A 4: 99,112,719 (GRCm39) V289I probably benign Het
Bbs7 A T 3: 36,657,022 (GRCm39) Y269N probably damaging Het
Bcas3 T A 11: 85,386,676 (GRCm39) D370E probably damaging Het
Bicc1 T G 10: 70,761,145 (GRCm39) E955A probably damaging Het
Bok T C 1: 93,616,999 (GRCm39) F115S probably damaging Het
Caap1 A T 4: 94,438,758 (GRCm39) probably null Het
Calcrl T A 2: 84,200,435 (GRCm39) D115V probably benign Het
Car7 A T 8: 105,270,170 (GRCm39) M57L probably benign Het
Casq1 G T 1: 172,037,957 (GRCm39) probably benign Het
Cep290 A T 10: 100,385,206 (GRCm39) D1894V possibly damaging Het
Clec4a2 T A 6: 123,100,588 (GRCm39) N14K probably damaging Het
Col16a1 G T 4: 129,984,290 (GRCm39) probably benign Het
Col5a1 T C 2: 27,880,109 (GRCm39) probably benign Het
Col5a2 A T 1: 45,417,642 (GRCm39) I1311N probably damaging Het
Col5a3 T C 9: 20,694,004 (GRCm39) T1050A probably damaging Het
Colgalt2 A T 1: 152,360,622 (GRCm39) I220F probably damaging Het
Cpb1 A T 3: 20,329,792 (GRCm39) V8E unknown Het
Dchs1 C T 7: 105,421,934 (GRCm39) R162H probably benign Het
Dhx37 A G 5: 125,499,295 (GRCm39) Y638H probably benign Het
Dhx40 T G 11: 86,662,088 (GRCm39) probably benign Het
Ehd2 T A 7: 15,686,001 (GRCm39) Q357L probably benign Het
Ewsr1 T C 11: 5,020,737 (GRCm39) probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Gid8 T A 2: 180,355,004 (GRCm39) Y3* probably null Het
Gm10212 A C 19: 11,548,174 (GRCm39) noncoding transcript Het
Grin3b T A 10: 79,809,890 (GRCm39) N465K possibly damaging Het
H1f3 A T 13: 23,739,924 (GRCm39) K221* probably null Het
Htr4 A T 18: 62,561,225 (GRCm39) N162I probably damaging Het
Irag2 T C 6: 145,110,938 (GRCm39) C248R probably damaging Het
Itga3 T C 11: 94,952,796 (GRCm39) D325G probably benign Het
Itpr3 T G 17: 27,330,903 (GRCm39) V1737G probably damaging Het
Kcnab2 C T 4: 152,479,439 (GRCm39) V251I probably benign Het
Kcnn2 A T 18: 45,693,215 (GRCm39) I264L probably benign Het
Klhl41 T C 2: 69,501,600 (GRCm39) Y354H probably damaging Het
Klra6 T C 6: 130,000,601 (GRCm39) I68V probably benign Het
Letm2 G T 8: 26,082,574 (GRCm39) P178Q probably damaging Het
Lypd11 C A 7: 24,422,170 (GRCm39) C193F possibly damaging Het
Mbtps1 A T 8: 120,249,340 (GRCm39) probably benign Het
Mecom C T 3: 30,035,121 (GRCm39) probably benign Het
Mrps5 T A 2: 127,433,745 (GRCm39) S45T possibly damaging Het
Msra T A 14: 64,678,210 (GRCm39) I29F possibly damaging Het
Mup5 T C 4: 61,751,229 (GRCm39) probably null Het
Myo1a T C 10: 127,555,111 (GRCm39) probably benign Het
Myrip C A 9: 120,270,443 (GRCm39) N564K probably benign Het
Naa20 T A 2: 145,757,592 (GRCm39) D148E probably damaging Het
Naga T G 15: 82,220,956 (GRCm39) probably benign Het
Npc1 A G 18: 12,346,503 (GRCm39) V231A probably benign Het
Nphs1 T C 7: 30,166,940 (GRCm39) F716L probably benign Het
Or8s5 T C 15: 98,238,810 (GRCm39) H20R probably benign Het
Parn G C 16: 13,472,299 (GRCm39) probably benign Het
Polk A T 13: 96,620,272 (GRCm39) C664S probably benign Het
Prkar2b A G 12: 32,026,034 (GRCm39) probably benign Het
Prkdc A G 16: 15,651,604 (GRCm39) E3747G probably damaging Het
Prmt5 A T 14: 54,748,712 (GRCm39) M362K probably damaging Het
Prob1 T C 18: 35,786,878 (GRCm39) T459A possibly damaging Het
Rttn C T 18: 89,108,543 (GRCm39) probably benign Het
Scn1a T C 2: 66,104,269 (GRCm39) M1664V probably damaging Het
Sez6 T A 11: 77,844,639 (GRCm39) L154H probably damaging Het
Sh3tc1 A G 5: 35,859,356 (GRCm39) probably benign Het
Shkbp1 C T 7: 27,048,006 (GRCm39) G334D probably damaging Het
Slc8a1 A T 17: 81,955,422 (GRCm39) F539I probably damaging Het
Spata31e5 G T 1: 28,817,223 (GRCm39) Q270K probably damaging Het
Sptan1 T C 2: 29,903,860 (GRCm39) probably benign Het
Ssc5d C T 7: 4,940,470 (GRCm39) T861M probably damaging Het
Tbx5 A T 5: 120,021,523 (GRCm39) M510L probably benign Het
Tdp1 A G 12: 99,876,101 (GRCm39) T351A probably benign Het
Tmc8 T A 11: 117,682,904 (GRCm39) probably benign Het
Tmco5 T A 2: 116,720,588 (GRCm39) D205E probably benign Het
Tmprss2 T C 16: 97,373,194 (GRCm39) probably benign Het
Top6bl A T 19: 4,708,442 (GRCm39) I350N probably damaging Het
Tph1 T A 7: 46,299,448 (GRCm39) K364N probably benign Het
Trim24 T C 6: 37,934,001 (GRCm39) L648P probably damaging Het
Trmt6 C A 2: 132,650,950 (GRCm39) probably benign Het
Ube2i A T 17: 25,488,259 (GRCm39) probably benign Het
Vcan A C 13: 89,852,779 (GRCm39) L727R possibly damaging Het
Vmn2r28 T C 7: 5,491,689 (GRCm39) Y186C probably damaging Het
Wars1 C A 12: 108,841,083 (GRCm39) D232Y probably damaging Het
Xrcc5 T C 1: 72,378,104 (GRCm39) probably benign Het
Zbtb24 T A 10: 41,340,532 (GRCm39) S543T probably damaging Het
Zfp91 A G 19: 12,753,353 (GRCm39) probably benign Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29,022,688 (GRCm39) splice site probably benign
IGL01150:Cacna2d3 APN 14 28,905,598 (GRCm39) missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28,665,548 (GRCm39) missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28,665,564 (GRCm39) missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 28,785,832 (GRCm39) unclassified probably benign
IGL02237:Cacna2d3 APN 14 29,068,954 (GRCm39) missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28,678,827 (GRCm39) splice site probably null
IGL02604:Cacna2d3 APN 14 29,015,066 (GRCm39) missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29,073,907 (GRCm39) splice site probably null
IGL02838:Cacna2d3 APN 14 29,022,785 (GRCm39) critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 28,786,276 (GRCm39) critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 28,780,388 (GRCm39) missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29,189,909 (GRCm39) missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28,674,243 (GRCm39) missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29,022,705 (GRCm39) missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29,442,834 (GRCm39) nonsense probably null
R0094:Cacna2d3 UTSW 14 28,892,460 (GRCm39) critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 28,767,601 (GRCm39) missense probably damaging 0.96
R0669:Cacna2d3 UTSW 14 29,189,906 (GRCm39) missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28,704,322 (GRCm39) missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 28,780,585 (GRCm39) missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 28,767,580 (GRCm39) missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 28,786,278 (GRCm39) splice site probably benign
R1312:Cacna2d3 UTSW 14 28,767,625 (GRCm39) missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28,703,137 (GRCm39) missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28,694,199 (GRCm39) missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28,691,171 (GRCm39) missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28,627,259 (GRCm39) missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 28,785,875 (GRCm39) missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29,068,880 (GRCm39) missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 28,905,538 (GRCm39) missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 28,825,670 (GRCm39) missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28,704,303 (GRCm39) missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29,015,092 (GRCm39) missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28,678,743 (GRCm39) splice site probably null
R4965:Cacna2d3 UTSW 14 28,704,289 (GRCm39) missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29,015,135 (GRCm39) missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29,068,987 (GRCm39) missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28,665,512 (GRCm39) critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29,442,891 (GRCm39) missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29,118,446 (GRCm39) missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28,630,278 (GRCm39) missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29,118,522 (GRCm39) missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 28,786,143 (GRCm39) unclassified probably benign
R6632:Cacna2d3 UTSW 14 28,627,222 (GRCm39) makesense probably null
R6706:Cacna2d3 UTSW 14 28,846,642 (GRCm39) critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 28,777,934 (GRCm39) missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28,691,275 (GRCm39) intron probably benign
R7009:Cacna2d3 UTSW 14 28,691,322 (GRCm39) start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28,691,260 (GRCm39) intron probably benign
R7146:Cacna2d3 UTSW 14 29,443,654 (GRCm39) missense unknown
R7427:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 28,780,575 (GRCm39) missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 28,767,501 (GRCm39) splice site probably null
R7560:Cacna2d3 UTSW 14 28,780,378 (GRCm39) missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 28,765,503 (GRCm39) missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 28,826,995 (GRCm39) splice site probably benign
R8096:Cacna2d3 UTSW 14 28,825,657 (GRCm39) missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28,704,328 (GRCm39) missense probably benign 0.25
R8814:Cacna2d3 UTSW 14 28,819,772 (GRCm39) missense probably damaging 1.00
R8838:Cacna2d3 UTSW 14 28,691,220 (GRCm39) missense probably benign 0.03
R8864:Cacna2d3 UTSW 14 29,055,735 (GRCm39) missense probably damaging 1.00
R9103:Cacna2d3 UTSW 14 29,068,971 (GRCm39) missense probably damaging 1.00
R9341:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9343:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9567:Cacna2d3 UTSW 14 28,627,268 (GRCm39) missense probably benign 0.38
Z1088:Cacna2d3 UTSW 14 28,786,265 (GRCm39) missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29,069,120 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CACCCTGTGCATGAAGAATGCAAAG -3'
(R):5'- AGATGCAACCTACTGTCTCCGACTC -3'

Sequencing Primer
(F):5'- TTTCTTGGCCCCCAAAGTG -3'
(R):5'- CGACTCCAACAGACATGGTG -3'
Posted On 2013-05-23