Incidental Mutation 'R5341:Bora'
Institutional Source Beutler Lab
Gene Symbol Bora
Ensembl Gene ENSMUSG00000022070
Gene Namebora, aurora kinase A activator
MMRRC Submission 042920-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R5341 (G1)
Quality Score225
Status Validated
Chromosomal Location99046222-99074540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99068094 bp
Amino Acid Change Tyrosine to Asparagine at position 300 (Y300N)
Ref Sequence ENSEMBL: ENSMUSP00000022656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022656] [ENSMUST00000227744]
Predicted Effect probably damaging
Transcript: ENSMUST00000022656
AA Change: Y300N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022656
Gene: ENSMUSG00000022070
AA Change: Y300N

Pfam:BORA_N 7 207 2.4e-69 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227744
Meta Mutation Damage Score 0.2612 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BORA is an activator of the protein kinase Aurora A (AURKA; MIM 603072), which is required for centrosome maturation, spindle assembly, and asymmetric protein localization during mitosis (Hutterer et al., 2006 [PubMed 16890155]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,110,381 probably benign Het
4931428F04Rik A T 8: 105,285,055 M226K probably damaging Het
Actr5 C A 2: 158,625,224 S28* probably null Het
Adcy1 A C 11: 7,130,375 M373L probably damaging Het
Adcyap1r1 C G 6: 55,478,069 F111L probably benign Het
Arid5b A T 10: 68,278,127 F27I possibly damaging Het
Art5 C A 7: 102,098,099 V158L probably benign Het
BC005561 A T 5: 104,518,076 T155S probably damaging Het
Btbd11 A G 10: 85,387,372 D15G unknown Het
Ccdc84 A G 9: 44,417,109 probably null Het
Cd300a A G 11: 114,893,462 T99A probably damaging Het
Cdon A G 9: 35,470,135 Y607C probably damaging Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Enox1 A C 14: 77,577,656 T85P possibly damaging Het
Fanci T C 7: 79,406,178 L158P probably damaging Het
Gbgt1 C A 2: 28,505,007 T219N probably damaging Het
Gm5689 A G 18: 42,173,431 D21G possibly damaging Het
Gm9513 A T 9: 36,477,061 K61* probably null Het
Gulo T C 14: 65,988,258 D373G probably benign Het
Hivep2 C A 10: 14,132,592 Q1645K possibly damaging Het
Iqce A C 5: 140,690,059 M114R possibly damaging Het
Lmbrd1 A T 1: 24,746,811 K396* probably null Het
Lrrk2 A T 15: 91,772,858 D1785V probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 9,940,917 probably null Het
Mepce A G 5: 137,783,260 V564A probably damaging Het
Mmp17 A T 5: 129,602,129 D364V possibly damaging Het
Mrgpre T C 7: 143,781,509 N86D probably benign Het
Olfr1276 T A 2: 111,257,637 I174K probably damaging Het
Olfr458 A T 6: 42,460,164 L285Q probably damaging Het
Pax5 T C 4: 44,697,630 D35G probably damaging Het
Pip5k1b T A 19: 24,304,076 T473S probably benign Het
Pkd2l2 A G 18: 34,409,934 probably null Het
Pygo2 C A 3: 89,432,760 P155Q probably damaging Het
Rb1cc1 G T 1: 6,215,042 probably benign Het
Rbpj A G 5: 53,642,083 E80G possibly damaging Het
Sbno1 A C 5: 124,408,475 probably null Het
Slc1a1 T A 19: 28,897,568 V182E probably benign Het
Slc34a3 A T 2: 25,230,659 F419I probably benign Het
Snx8 A G 5: 140,358,131 V62A probably damaging Het
Sp9 T C 2: 73,274,514 S471P possibly damaging Het
Sspo A T 6: 48,459,615 S1270C probably damaging Het
Stk11 A T 10: 80,126,260 T83S probably benign Het
Syt13 A G 2: 92,953,552 E389G probably benign Het
Taf10 T C 7: 105,740,932 probably benign Het
Tgm1 A T 14: 55,700,248 S801R possibly damaging Het
Timeless T C 10: 128,247,178 F628L possibly damaging Het
Tmem171 G T 13: 98,688,448 P225T probably damaging Het
Tspan12 A T 6: 21,835,459 C72S possibly damaging Het
Txk T C 5: 72,696,621 T458A probably benign Het
Txndc9 A G 1: 37,987,623 probably benign Het
Uap1 C A 1: 170,143,431 C464F probably damaging Het
Ugt2b36 A T 5: 87,092,228 Y99* probably null Het
Usp35 T C 7: 97,325,927 Y13C probably damaging Het
Vmn1r6 T G 6: 57,002,804 N128K probably damaging Het
Vmn2r106 T A 17: 20,277,526 I484L probably benign Het
Wdr60 T C 12: 116,255,914 E136G possibly damaging Het
Zdbf2 T A 1: 63,307,933 S1824T probably benign Het
Zdhhc4 A G 5: 143,326,160 V19A probably benign Het
Zfp955b C T 17: 33,305,121 probably benign Het
Zfp97 T A 17: 17,145,210 C324S probably damaging Het
Zswim8 G A 14: 20,716,054 D803N probably damaging Het
Other mutations in Bora
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Bora APN 14 99047377 missense probably damaging 1.00
IGL02119:Bora APN 14 99053538 missense probably damaging 1.00
IGL02129:Bora APN 14 99056821 critical splice donor site probably null
IGL02171:Bora APN 14 99047322 missense probably damaging 1.00
IGL03338:Bora APN 14 99072742 missense probably damaging 1.00
R0504:Bora UTSW 14 99061623 nonsense probably null
R1598:Bora UTSW 14 99068404 missense probably benign
R2070:Bora UTSW 14 99062278 missense probably damaging 1.00
R2071:Bora UTSW 14 99062278 missense probably damaging 1.00
R4521:Bora UTSW 14 99068548 missense probably damaging 0.99
R4861:Bora UTSW 14 99047474 splice site probably null
R4881:Bora UTSW 14 99061567 missense probably damaging 1.00
R4982:Bora UTSW 14 99047352 missense probably damaging 1.00
R5378:Bora UTSW 14 99068493 missense probably damaging 1.00
R5913:Bora UTSW 14 99068512 missense probably benign 0.02
R6082:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6083:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6084:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6085:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6086:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6269:Bora UTSW 14 99073667 missense probably damaging 0.99
R7354:Bora UTSW 14 99047358 missense probably damaging 1.00
R7794:Bora UTSW 14 99072644 missense possibly damaging 0.50
R7962:Bora UTSW 14 99072726 missense probably benign 0.01
R8299:Bora UTSW 14 99068134 missense probably benign 0.35
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-08-04