Incidental Mutation 'R5341:1700017D01Rik'
ID422361
Institutional Source Beutler Lab
Gene Symbol 1700017D01Rik
Ensembl Gene ENSMUSG00000024729
Gene NameRIKEN cDNA 1700017D01 gene
Synonyms
MMRRC Submission 042920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5341 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11096816-11130876 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 11110381 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025635]
Predicted Effect probably benign
Transcript: ENSMUST00000025635
SMART Domains Protein: ENSMUSP00000025635
Gene: ENSMUSG00000024729

DomainStartEndE-ValueType
Pfam:CD20 18 118 2.4e-8 PFAM
transmembrane domain 130 152 N/A INTRINSIC
low complexity region 169 185 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188756
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik A T 8: 105,285,055 M226K probably damaging Het
Actr5 C A 2: 158,625,224 S28* probably null Het
Adcy1 A C 11: 7,130,375 M373L probably damaging Het
Adcyap1r1 C G 6: 55,478,069 F111L probably benign Het
Arid5b A T 10: 68,278,127 F27I possibly damaging Het
Art5 C A 7: 102,098,099 V158L probably benign Het
BC005561 A T 5: 104,518,076 T155S probably damaging Het
Bora T A 14: 99,068,094 Y300N probably damaging Het
Btbd11 A G 10: 85,387,372 D15G unknown Het
Ccdc84 A G 9: 44,417,109 probably null Het
Cd300a A G 11: 114,893,462 T99A probably damaging Het
Cdon A G 9: 35,470,135 Y607C probably damaging Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Dhx8 AGACCGGGACCGGGACCGGGACCGGGAC AGACCGGGACCGGGACCGGGAC 11: 101,738,190 probably benign Het
Enox1 A C 14: 77,577,656 T85P possibly damaging Het
Fanci T C 7: 79,406,178 L158P probably damaging Het
Gbgt1 C A 2: 28,505,007 T219N probably damaging Het
Gm5689 A G 18: 42,173,431 D21G possibly damaging Het
Gm9513 A T 9: 36,477,061 K61* probably null Het
Gulo T C 14: 65,988,258 D373G probably benign Het
Hivep2 C A 10: 14,132,592 Q1645K possibly damaging Het
Iqce A C 5: 140,690,059 M114R possibly damaging Het
Lmbrd1 A T 1: 24,746,811 K396* probably null Het
Lrrk2 A T 15: 91,772,858 D1785V probably damaging Het
Mcmdc2 ATAAAAAAAAAGGAAAAATTACCTT AT 1: 9,940,917 probably null Het
Mepce A G 5: 137,783,260 V564A probably damaging Het
Mmp17 A T 5: 129,602,129 D364V possibly damaging Het
Mrgpre T C 7: 143,781,509 N86D probably benign Het
Olfr1276 T A 2: 111,257,637 I174K probably damaging Het
Olfr458 A T 6: 42,460,164 L285Q probably damaging Het
Pax5 T C 4: 44,697,630 D35G probably damaging Het
Pip5k1b T A 19: 24,304,076 T473S probably benign Het
Pkd2l2 A G 18: 34,409,934 probably null Het
Pygo2 C A 3: 89,432,760 P155Q probably damaging Het
Rb1cc1 G T 1: 6,215,042 probably benign Het
Rbpj A G 5: 53,642,083 E80G possibly damaging Het
Sbno1 A C 5: 124,408,475 probably null Het
Slc1a1 T A 19: 28,897,568 V182E probably benign Het
Slc34a3 A T 2: 25,230,659 F419I probably benign Het
Snx8 A G 5: 140,358,131 V62A probably damaging Het
Sp9 T C 2: 73,274,514 S471P possibly damaging Het
Sspo A T 6: 48,459,615 S1270C probably damaging Het
Stk11 A T 10: 80,126,260 T83S probably benign Het
Syt13 A G 2: 92,953,552 E389G probably benign Het
Taf10 T C 7: 105,740,932 probably benign Het
Tgm1 A T 14: 55,700,248 S801R possibly damaging Het
Timeless T C 10: 128,247,178 F628L possibly damaging Het
Tmem171 G T 13: 98,688,448 P225T probably damaging Het
Tspan12 A T 6: 21,835,459 C72S possibly damaging Het
Txk T C 5: 72,696,621 T458A probably benign Het
Txndc9 A G 1: 37,987,623 probably benign Het
Uap1 C A 1: 170,143,431 C464F probably damaging Het
Ugt2b36 A T 5: 87,092,228 Y99* probably null Het
Usp35 T C 7: 97,325,927 Y13C probably damaging Het
Vmn1r6 T G 6: 57,002,804 N128K probably damaging Het
Vmn2r106 T A 17: 20,277,526 I484L probably benign Het
Wdr60 T C 12: 116,255,914 E136G possibly damaging Het
Zdbf2 T A 1: 63,307,933 S1824T probably benign Het
Zdhhc4 A G 5: 143,326,160 V19A probably benign Het
Zfp955b C T 17: 33,305,121 probably benign Het
Zfp97 T A 17: 17,145,210 C324S probably damaging Het
Zswim8 G A 14: 20,716,054 D803N probably damaging Het
Other mutations in 1700017D01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:1700017D01Rik APN 19 11110331 nonsense probably null
IGL02182:1700017D01Rik APN 19 11097072 splice site probably benign
IGL03156:1700017D01Rik APN 19 11105750 missense possibly damaging 0.80
R0189:1700017D01Rik UTSW 19 11096947 missense possibly damaging 0.46
R0218:1700017D01Rik UTSW 19 11116437 nonsense probably null
R0464:1700017D01Rik UTSW 19 11112437 missense probably damaging 1.00
R0617:1700017D01Rik UTSW 19 11112400 missense probably damaging 1.00
R1171:1700017D01Rik UTSW 19 11112377 missense probably damaging 0.97
R2341:1700017D01Rik UTSW 19 11105793 missense probably benign
R5099:1700017D01Rik UTSW 19 11112461 critical splice acceptor site probably null
R5330:1700017D01Rik UTSW 19 11091858 unclassified probably benign
R5331:1700017D01Rik UTSW 19 11091858 unclassified probably benign
R6109:1700017D01Rik UTSW 19 11101912 missense possibly damaging 0.66
R6177:1700017D01Rik UTSW 19 11105750 missense possibly damaging 0.53
R6970:1700017D01Rik UTSW 19 11112314 critical splice donor site probably null
R7038:1700017D01Rik UTSW 19 11110311 missense probably benign
R7584:1700017D01Rik UTSW 19 11110361 missense possibly damaging 0.94
R7752:1700017D01Rik UTSW 19 11101860 missense probably benign 0.02
R7854:1700017D01Rik UTSW 19 11112377 missense probably benign 0.01
R8261:1700017D01Rik UTSW 19 11110343 missense probably damaging 0.97
X0019:1700017D01Rik UTSW 19 11105792 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAAGCTTTCTCACTCCCC -3'
(R):5'- GTTGATCGCATGAATGACCATC -3'

Sequencing Primer
(F):5'- CCCTTCCAAGTCTCAGAATCATC -3'
(R):5'- CTCAGGGATAGTCTAGACATC -3'
Posted On2016-08-04