Incidental Mutation 'R5342:Sgpp2'
ID422366
Institutional Source Beutler Lab
Gene Symbol Sgpp2
Ensembl Gene ENSMUSG00000032908
Gene Namesphingosine-1-phosphate phosphotase 2
Synonyms
MMRRC Submission 042921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5342 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location78310345-78420289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78360188 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 68 (I68V)
Ref Sequence ENSEMBL: ENSMUSP00000036656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036172]
Predicted Effect probably benign
Transcript: ENSMUST00000036172
AA Change: I68V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036656
Gene: ENSMUSG00000032908
AA Change: I68V

DomainStartEndE-ValueType
acidPPc 74 188 7.56e-5 SMART
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 271 293 N/A INTRINSIC
transmembrane domain 330 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein that degrades the bioactive signaling molecule sphingosine 1-phosphate. The encoded protein is induced during inflammatory responses and has been shown to be downregulated by the microRNA-31 tumor suppressor. Alternative splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased pancreatic beta cell endoplasmic reticulum stress under basal conditions and decreased adaptive beta cell proliferation in response to treatment with either a high-fat diet or the beta cell-specific toxin, streptozotocin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 A C 8: 27,226,781 Y392* probably null Het
Arap1 G A 7: 101,404,960 E1330K probably benign Het
Atg2b G T 12: 105,658,916 D600E possibly damaging Het
Atp1b2 C T 11: 69,602,828 V142I probably damaging Het
AW551984 A T 9: 39,594,551 M450K probably damaging Het
BC067074 T C 13: 113,366,269 probably null Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Ccnt2 T C 1: 127,791,733 silent Het
Cdca7l A G 12: 117,877,033 Y430C probably damaging Het
Ces4a A G 8: 105,146,143 T343A probably benign Het
Clec2g C T 6: 128,948,751 A41V probably benign Het
Crybg3 A T 16: 59,522,149 Y2708N probably damaging Het
Dmxl1 A T 18: 49,951,235 E2758V probably damaging Het
Dusp27 T C 1: 166,110,250 E80G probably benign Het
Eci2 C T 13: 34,978,724 E283K probably benign Het
Edrf1 T A 7: 133,651,910 probably null Het
Eif3b T C 5: 140,425,280 L162P probably damaging Het
Ercc3 A G 18: 32,245,595 I210V probably benign Het
Exoc1 A G 5: 76,567,014 N739S probably damaging Het
Gm7334 A G 17: 50,698,754 K23E probably benign Het
Gm7356 T G 17: 14,001,098 D223A possibly damaging Het
Klhl26 A G 8: 70,455,565 L47P probably damaging Het
Klhl42 C T 6: 147,092,286 T252I possibly damaging Het
Morc1 G T 16: 48,618,509 G756W probably damaging Het
Mroh2b G T 15: 4,914,133 E384* probably null Het
Nol10 G A 12: 17,369,620 probably null Het
Nxpe5 T C 5: 138,239,241 L9P probably damaging Het
Olfr457 A G 6: 42,471,902 I92T probably damaging Het
Olfr617 C T 7: 103,584,828 R269C probably benign Het
Olfr857 A G 9: 19,713,037 D70G probably damaging Het
Pak2 T C 16: 32,044,488 E94G probably damaging Het
Pcdha7 A G 18: 36,974,671 K250E possibly damaging Het
Pde8b T C 13: 95,041,990 T541A probably damaging Het
Peg3 A T 7: 6,709,970 I751N probably damaging Het
Prpsap2 T C 11: 61,731,570 D269G probably damaging Het
Raver2 C A 4: 101,102,692 T123K possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Scn2b A G 9: 45,125,518 Y108C probably damaging Het
Sdr16c6 T C 4: 4,069,923 E139G probably damaging Het
Sorbs2 T A 8: 45,796,013 I687N probably damaging Het
Sorcs3 G A 19: 48,796,472 probably null Het
Stk16 T A 1: 75,212,965 C174S probably benign Het
Ttll9 C A 2: 152,991,652 N198K possibly damaging Het
Unc13c A T 9: 73,930,823 D915E probably benign Het
Unc5b T A 10: 60,778,267 K268* probably null Het
Vim T A 2: 13,580,013 probably null Het
Xirp2 T A 2: 67,513,461 N2015K probably damaging Het
Zfp160 T G 17: 21,020,733 M21R possibly damaging Het
Other mutations in Sgpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Sgpp2 APN 1 78390547 missense probably benign 0.00
IGL01646:Sgpp2 APN 1 78416896 missense probably damaging 0.98
IGL02797:Sgpp2 APN 1 78417182 missense probably benign
IGL03329:Sgpp2 APN 1 78390563 missense probably benign
R2024:Sgpp2 UTSW 1 78417220 missense probably benign 0.06
R2056:Sgpp2 UTSW 1 78416951 missense probably damaging 0.99
R2059:Sgpp2 UTSW 1 78416951 missense probably damaging 0.99
R2309:Sgpp2 UTSW 1 78417349 missense probably damaging 0.99
R2570:Sgpp2 UTSW 1 78360150 missense possibly damaging 0.80
R6209:Sgpp2 UTSW 1 78390482 missense probably damaging 1.00
R6645:Sgpp2 UTSW 1 78360162 missense probably damaging 1.00
R8186:Sgpp2 UTSW 1 78416972 missense probably benign 0.00
Z1176:Sgpp2 UTSW 1 78417365 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGTCAGGAGGATGCAGCATC -3'
(R):5'- CCATGAAGTCACAGGTTGGTCTG -3'

Sequencing Primer
(F):5'- AGCATCCTGGTGATAAGTTTGG -3'
(R):5'- CCTTAGATGTGTCTGCAATC -3'
Posted On2016-08-04