Incidental Mutation 'R5342:Styxl2'
ID 422367
Institutional Source Beutler Lab
Gene Symbol Styxl2
Ensembl Gene ENSMUSG00000026564
Gene Name serine/threonine/tyrosine interacting like 2
Synonyms C130085G02Rik, Dusp27
MMRRC Submission 042921-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5342 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 165925717-165955467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 165937819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 80 (E80G)
Ref Sequence ENSEMBL: ENSMUSP00000141564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
AlphaFold Q148W8
Predicted Effect probably benign
Transcript: ENSMUST00000085992
AA Change: E80G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: E80G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192369
AA Change: E80G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: E80G

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 A C 8: 27,716,809 (GRCm39) Y392* probably null Het
Arap1 G A 7: 101,054,167 (GRCm39) E1330K probably benign Het
Atg2b G T 12: 105,625,175 (GRCm39) D600E possibly damaging Het
Atp1b2 C T 11: 69,493,654 (GRCm39) V142I probably damaging Het
AW551984 A T 9: 39,505,847 (GRCm39) M450K probably damaging Het
Bcar3 A G 3: 122,220,298 (GRCm39) D65G probably damaging Het
Ccnt2 T C 1: 127,719,470 (GRCm39) silent Het
Cdca7l A G 12: 117,840,768 (GRCm39) Y430C probably damaging Het
Ces4a A G 8: 105,872,775 (GRCm39) T343A probably benign Het
Clec2g C T 6: 128,925,714 (GRCm39) A41V probably benign Het
Crybg3 A T 16: 59,342,512 (GRCm39) Y2708N probably damaging Het
Cspg4b T C 13: 113,502,803 (GRCm39) probably null Het
Dmxl1 A T 18: 50,084,302 (GRCm39) E2758V probably damaging Het
Eci2 C T 13: 35,162,707 (GRCm39) E283K probably benign Het
Edrf1 T A 7: 133,253,639 (GRCm39) probably null Het
Eif3b T C 5: 140,411,035 (GRCm39) L162P probably damaging Het
Ercc3 A G 18: 32,378,648 (GRCm39) I210V probably benign Het
Exoc1 A G 5: 76,714,861 (GRCm39) N739S probably damaging Het
Gm7334 A G 17: 51,005,782 (GRCm39) K23E probably benign Het
Gm7356 T G 17: 14,221,360 (GRCm39) D223A possibly damaging Het
Klhl26 A G 8: 70,908,215 (GRCm39) L47P probably damaging Het
Klhl42 C T 6: 146,993,784 (GRCm39) T252I possibly damaging Het
Morc1 G T 16: 48,438,872 (GRCm39) G756W probably damaging Het
Mroh2b G T 15: 4,943,615 (GRCm39) E384* probably null Het
Nol10 G A 12: 17,419,621 (GRCm39) probably null Het
Nxpe5 T C 5: 138,237,503 (GRCm39) L9P probably damaging Het
Or2r3 A G 6: 42,448,836 (GRCm39) I92T probably damaging Het
Or52z12 C T 7: 103,234,035 (GRCm39) R269C probably benign Het
Or7e166 A G 9: 19,624,333 (GRCm39) D70G probably damaging Het
Pak2 T C 16: 31,863,306 (GRCm39) E94G probably damaging Het
Pcdha7 A G 18: 37,107,724 (GRCm39) K250E possibly damaging Het
Pde8b T C 13: 95,178,498 (GRCm39) T541A probably damaging Het
Peg3 A T 7: 6,712,969 (GRCm39) I751N probably damaging Het
Prpsap2 T C 11: 61,622,396 (GRCm39) D269G probably damaging Het
Raver2 C A 4: 100,959,889 (GRCm39) T123K possibly damaging Het
Rpgrip1 G A 14: 52,382,666 (GRCm39) D600N possibly damaging Het
Scn2b A G 9: 45,036,816 (GRCm39) Y108C probably damaging Het
Sdr16c6 T C 4: 4,069,923 (GRCm39) E139G probably damaging Het
Sgpp2 A G 1: 78,336,825 (GRCm39) I68V probably benign Het
Sorbs2 T A 8: 46,249,050 (GRCm39) I687N probably damaging Het
Sorcs3 G A 19: 48,784,911 (GRCm39) probably null Het
Stk16 T A 1: 75,189,609 (GRCm39) C174S probably benign Het
Ttll9 C A 2: 152,833,572 (GRCm39) N198K possibly damaging Het
Unc13c A T 9: 73,838,105 (GRCm39) D915E probably benign Het
Unc5b T A 10: 60,614,046 (GRCm39) K268* probably null Het
Vim T A 2: 13,584,824 (GRCm39) probably null Het
Xirp2 T A 2: 67,343,805 (GRCm39) N2015K probably damaging Het
Zfp160 T G 17: 21,240,995 (GRCm39) M21R possibly damaging Het
Other mutations in Styxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Styxl2 APN 1 165,928,121 (GRCm39) missense probably benign 0.00
IGL00973:Styxl2 APN 1 165,927,027 (GRCm39) missense probably benign
IGL01331:Styxl2 APN 1 165,935,749 (GRCm39) missense probably damaging 1.00
IGL01466:Styxl2 APN 1 165,928,073 (GRCm39) missense probably damaging 1.00
IGL01572:Styxl2 APN 1 165,927,941 (GRCm39) missense probably benign 0.18
IGL01906:Styxl2 APN 1 165,927,092 (GRCm39) missense probably damaging 1.00
IGL01974:Styxl2 APN 1 165,928,105 (GRCm39) nonsense probably null
IGL02112:Styxl2 APN 1 165,927,240 (GRCm39) nonsense probably null
IGL02805:Styxl2 APN 1 165,926,630 (GRCm39) missense probably damaging 1.00
IGL03343:Styxl2 APN 1 165,927,017 (GRCm39) missense probably benign 0.00
R0116:Styxl2 UTSW 1 165,927,270 (GRCm39) missense probably benign 0.19
R0367:Styxl2 UTSW 1 165,928,332 (GRCm39) missense probably benign 0.05
R0499:Styxl2 UTSW 1 165,926,670 (GRCm39) missense probably benign 0.00
R0542:Styxl2 UTSW 1 165,928,853 (GRCm39) missense possibly damaging 0.90
R1312:Styxl2 UTSW 1 165,926,860 (GRCm39) missense possibly damaging 0.46
R1572:Styxl2 UTSW 1 165,927,024 (GRCm39) missense possibly damaging 0.68
R1598:Styxl2 UTSW 1 165,937,828 (GRCm39) missense probably benign 0.10
R1858:Styxl2 UTSW 1 165,928,415 (GRCm39) missense possibly damaging 0.87
R2021:Styxl2 UTSW 1 165,928,392 (GRCm39) missense probably benign 0.00
R2970:Styxl2 UTSW 1 165,926,798 (GRCm39) missense probably benign 0.04
R3727:Styxl2 UTSW 1 165,927,075 (GRCm39) missense probably damaging 1.00
R4041:Styxl2 UTSW 1 165,927,680 (GRCm39) missense probably benign 0.01
R4245:Styxl2 UTSW 1 165,928,685 (GRCm39) missense probably damaging 1.00
R4955:Styxl2 UTSW 1 165,935,661 (GRCm39) missense probably damaging 1.00
R4967:Styxl2 UTSW 1 165,954,675 (GRCm39) missense probably damaging 1.00
R5040:Styxl2 UTSW 1 165,927,914 (GRCm39) missense probably benign 0.17
R5467:Styxl2 UTSW 1 165,939,599 (GRCm39) critical splice donor site probably null
R5742:Styxl2 UTSW 1 165,927,023 (GRCm39) missense probably benign 0.00
R6222:Styxl2 UTSW 1 165,926,214 (GRCm39) missense probably benign 0.26
R6239:Styxl2 UTSW 1 165,926,388 (GRCm39) missense probably damaging 1.00
R6531:Styxl2 UTSW 1 165,937,615 (GRCm39) splice site probably null
R6586:Styxl2 UTSW 1 165,928,454 (GRCm39) missense possibly damaging 0.79
R6958:Styxl2 UTSW 1 165,935,565 (GRCm39) missense probably damaging 1.00
R7006:Styxl2 UTSW 1 165,926,663 (GRCm39) missense probably benign
R7111:Styxl2 UTSW 1 165,954,723 (GRCm39) missense possibly damaging 0.66
R7310:Styxl2 UTSW 1 165,926,300 (GRCm39) missense possibly damaging 0.46
R7312:Styxl2 UTSW 1 165,954,676 (GRCm39) missense probably damaging 0.99
R7378:Styxl2 UTSW 1 165,939,632 (GRCm39) nonsense probably null
R7398:Styxl2 UTSW 1 165,928,044 (GRCm39) missense probably damaging 1.00
R7442:Styxl2 UTSW 1 165,928,584 (GRCm39) missense probably benign 0.01
R7569:Styxl2 UTSW 1 165,935,604 (GRCm39) missense probably damaging 1.00
R7920:Styxl2 UTSW 1 165,927,465 (GRCm39) missense possibly damaging 0.72
R7954:Styxl2 UTSW 1 165,926,849 (GRCm39) missense probably benign 0.05
R7972:Styxl2 UTSW 1 165,926,708 (GRCm39) missense probably damaging 1.00
R8186:Styxl2 UTSW 1 165,927,648 (GRCm39) missense probably damaging 1.00
R8354:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8454:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8535:Styxl2 UTSW 1 165,928,730 (GRCm39) missense probably benign 0.01
R9419:Styxl2 UTSW 1 165,927,755 (GRCm39) missense probably damaging 1.00
R9493:Styxl2 UTSW 1 165,926,410 (GRCm39) missense probably damaging 1.00
R9694:Styxl2 UTSW 1 165,928,654 (GRCm39) missense probably damaging 1.00
Z1088:Styxl2 UTSW 1 165,926,852 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAGCTATGAAGACGTTGGG -3'
(R):5'- TGTCATGGTCCTCCTGAGTC -3'

Sequencing Primer
(F):5'- CTATGAAGACGTTGGGCCACAC -3'
(R):5'- GGTCCTCCTGAGTCCCAATGAAAC -3'
Posted On 2016-08-04