Incidental Mutation 'R5342:Ttll9'
ID422371
Institutional Source Beutler Lab
Gene Symbol Ttll9
Ensembl Gene ENSMUSG00000074673
Gene Nametubulin tyrosine ligase-like family, member 9
Synonyms4930509O20Rik, 1700016F23Rik
MMRRC Submission 042921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5342 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location152962485-153008482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 152991652 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 198 (N198K)
Ref Sequence ENSEMBL: ENSMUSP00000105426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099197] [ENSMUST00000103155] [ENSMUST00000109801] [ENSMUST00000146626] [ENSMUST00000152158] [ENSMUST00000165343]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099197
AA Change: N223K

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096803
Gene: ENSMUSG00000074673
AA Change: N223K

DomainStartEndE-ValueType
Pfam:TTL 69 397 2.2e-87 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103155
AA Change: N223K

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099444
Gene: ENSMUSG00000074673
AA Change: N223K

DomainStartEndE-ValueType
Pfam:TTL 67 397 5.3e-88 PFAM
low complexity region 452 461 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109801
AA Change: N198K

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105426
Gene: ENSMUSG00000074673
AA Change: N198K

DomainStartEndE-ValueType
Pfam:TTL 68 222 4.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130021
Predicted Effect probably benign
Transcript: ENSMUST00000146626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151641
Predicted Effect probably benign
Transcript: ENSMUST00000152158
Predicted Effect unknown
Transcript: ENSMUST00000165343
AA Change: T71N
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 A C 8: 27,226,781 Y392* probably null Het
Arap1 G A 7: 101,404,960 E1330K probably benign Het
Atg2b G T 12: 105,658,916 D600E possibly damaging Het
Atp1b2 C T 11: 69,602,828 V142I probably damaging Het
AW551984 A T 9: 39,594,551 M450K probably damaging Het
BC067074 T C 13: 113,366,269 probably null Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Ccnt2 T C 1: 127,791,733 silent Het
Cdca7l A G 12: 117,877,033 Y430C probably damaging Het
Ces4a A G 8: 105,146,143 T343A probably benign Het
Clec2g C T 6: 128,948,751 A41V probably benign Het
Crybg3 A T 16: 59,522,149 Y2708N probably damaging Het
Dmxl1 A T 18: 49,951,235 E2758V probably damaging Het
Dusp27 T C 1: 166,110,250 E80G probably benign Het
Eci2 C T 13: 34,978,724 E283K probably benign Het
Edrf1 T A 7: 133,651,910 probably null Het
Eif3b T C 5: 140,425,280 L162P probably damaging Het
Ercc3 A G 18: 32,245,595 I210V probably benign Het
Exoc1 A G 5: 76,567,014 N739S probably damaging Het
Gm7334 A G 17: 50,698,754 K23E probably benign Het
Gm7356 T G 17: 14,001,098 D223A possibly damaging Het
Klhl26 A G 8: 70,455,565 L47P probably damaging Het
Klhl42 C T 6: 147,092,286 T252I possibly damaging Het
Morc1 G T 16: 48,618,509 G756W probably damaging Het
Mroh2b G T 15: 4,914,133 E384* probably null Het
Nol10 G A 12: 17,369,620 probably null Het
Nxpe5 T C 5: 138,239,241 L9P probably damaging Het
Olfr457 A G 6: 42,471,902 I92T probably damaging Het
Olfr617 C T 7: 103,584,828 R269C probably benign Het
Olfr857 A G 9: 19,713,037 D70G probably damaging Het
Pak2 T C 16: 32,044,488 E94G probably damaging Het
Pcdha7 A G 18: 36,974,671 K250E possibly damaging Het
Pde8b T C 13: 95,041,990 T541A probably damaging Het
Peg3 A T 7: 6,709,970 I751N probably damaging Het
Prpsap2 T C 11: 61,731,570 D269G probably damaging Het
Raver2 C A 4: 101,102,692 T123K possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Scn2b A G 9: 45,125,518 Y108C probably damaging Het
Sdr16c6 T C 4: 4,069,923 E139G probably damaging Het
Sgpp2 A G 1: 78,360,188 I68V probably benign Het
Sorbs2 T A 8: 45,796,013 I687N probably damaging Het
Sorcs3 G A 19: 48,796,472 probably null Het
Stk16 T A 1: 75,212,965 C174S probably benign Het
Unc13c A T 9: 73,930,823 D915E probably benign Het
Unc5b T A 10: 60,778,267 K268* probably null Het
Vim T A 2: 13,580,013 probably null Het
Xirp2 T A 2: 67,513,461 N2015K probably damaging Het
Zfp160 T G 17: 21,020,733 M21R possibly damaging Het
Other mutations in Ttll9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Ttll9 APN 2 152984260 missense probably damaging 0.99
IGL01107:Ttll9 APN 2 153002889 splice site probably benign
IGL01365:Ttll9 APN 2 153000134 missense possibly damaging 0.87
IGL01751:Ttll9 APN 2 152983105 missense probably damaging 0.99
IGL02264:Ttll9 APN 2 153000135 missense probably damaging 1.00
IGL02477:Ttll9 APN 2 153000197 missense possibly damaging 0.77
IGL02899:Ttll9 APN 2 153002951 missense probably damaging 0.99
BB001:Ttll9 UTSW 2 152962487 unclassified probably benign
BB011:Ttll9 UTSW 2 152962487 unclassified probably benign
I2288:Ttll9 UTSW 2 152972339 splice site probably benign
R0053:Ttll9 UTSW 2 152962506 utr 5 prime probably benign
R0116:Ttll9 UTSW 2 152983134 missense probably damaging 0.99
R0319:Ttll9 UTSW 2 153000098 splice site probably null
R0388:Ttll9 UTSW 2 153000179 missense probably benign
R0556:Ttll9 UTSW 2 152973606 critical splice donor site probably null
R0689:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R1829:Ttll9 UTSW 2 153000236 missense possibly damaging 0.61
R2016:Ttll9 UTSW 2 153002294 missense probably damaging 1.00
R2144:Ttll9 UTSW 2 153003007 missense probably benign
R2229:Ttll9 UTSW 2 152983063 missense probably damaging 0.98
R2309:Ttll9 UTSW 2 152984145 missense probably damaging 1.00
R2314:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R4191:Ttll9 UTSW 2 153003007 missense probably benign
R4539:Ttll9 UTSW 2 152994091 missense probably damaging 1.00
R4866:Ttll9 UTSW 2 153003000 missense probably benign 0.02
R5115:Ttll9 UTSW 2 152989590 intron probably benign
R5279:Ttll9 UTSW 2 152962544 missense possibly damaging 0.80
R5375:Ttll9 UTSW 2 152984224 missense probably benign 0.13
R5417:Ttll9 UTSW 2 153002992 missense probably benign
R5555:Ttll9 UTSW 2 152990100 critical splice donor site probably null
R5574:Ttll9 UTSW 2 152984248 missense possibly damaging 0.90
R5598:Ttll9 UTSW 2 152984314 missense probably damaging 1.00
R5613:Ttll9 UTSW 2 152973601 frame shift probably null
R6366:Ttll9 UTSW 2 152991605 missense probably damaging 0.99
R6409:Ttll9 UTSW 2 152999341 missense probably damaging 1.00
R6655:Ttll9 UTSW 2 153000303 splice site probably null
R6657:Ttll9 UTSW 2 152984262 missense probably damaging 1.00
R6766:Ttll9 UTSW 2 152999300 nonsense probably null
R7012:Ttll9 UTSW 2 153003062 missense possibly damaging 0.46
R7162:Ttll9 UTSW 2 152989603 missense probably damaging 0.99
R7804:Ttll9 UTSW 2 153002358 critical splice donor site probably null
R7862:Ttll9 UTSW 2 153006975 missense probably benign 0.00
R7924:Ttll9 UTSW 2 152962487 unclassified probably benign
R7998:Ttll9 UTSW 2 152991626 missense possibly damaging 0.55
R8041:Ttll9 UTSW 2 153003036 missense possibly damaging 0.62
R8367:Ttll9 UTSW 2 152994148 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAAATGCCAATGTCCACATGTG -3'
(R):5'- TGGGGTCATTGCAGAGTCAC -3'

Sequencing Primer
(F):5'- CTTACCTTAGAGACTCGACGTAAGG -3'
(R):5'- GGTCATTGCAGAGTCACAGCTAC -3'
Posted On2016-08-04