Incidental Mutation 'R5342:Klhl42'
ID422382
Institutional Source Beutler Lab
Gene Symbol Klhl42
Ensembl Gene ENSMUSG00000040102
Gene Namekelch-like 42
SynonymsKlhdc5, C230080I20Rik
MMRRC Submission 042921-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5342 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location147091379-147112778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 147092286 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 252 (T252I)
Ref Sequence ENSEMBL: ENSMUSP00000042558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036003]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036003
AA Change: T252I

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042558
Gene: ENSMUSG00000040102
AA Change: T252I

DomainStartEndE-ValueType
BTB 5 145 1.14e-1 SMART
low complexity region 151 164 N/A INTRINSIC
Kelch 242 289 1.79e-5 SMART
Kelch 290 332 1.25e-9 SMART
Kelch 333 379 1.56e1 SMART
Blast:Kelch 380 437 3e-31 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 A C 8: 27,226,781 Y392* probably null Het
Arap1 G A 7: 101,404,960 E1330K probably benign Het
Atg2b G T 12: 105,658,916 D600E possibly damaging Het
Atp1b2 C T 11: 69,602,828 V142I probably damaging Het
AW551984 A T 9: 39,594,551 M450K probably damaging Het
BC067074 T C 13: 113,366,269 probably null Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Ccnt2 T C 1: 127,791,733 silent Het
Cdca7l A G 12: 117,877,033 Y430C probably damaging Het
Ces4a A G 8: 105,146,143 T343A probably benign Het
Clec2g C T 6: 128,948,751 A41V probably benign Het
Crybg3 A T 16: 59,522,149 Y2708N probably damaging Het
Dmxl1 A T 18: 49,951,235 E2758V probably damaging Het
Dusp27 T C 1: 166,110,250 E80G probably benign Het
Eci2 C T 13: 34,978,724 E283K probably benign Het
Edrf1 T A 7: 133,651,910 probably null Het
Eif3b T C 5: 140,425,280 L162P probably damaging Het
Ercc3 A G 18: 32,245,595 I210V probably benign Het
Exoc1 A G 5: 76,567,014 N739S probably damaging Het
Gm7334 A G 17: 50,698,754 K23E probably benign Het
Gm7356 T G 17: 14,001,098 D223A possibly damaging Het
Klhl26 A G 8: 70,455,565 L47P probably damaging Het
Morc1 G T 16: 48,618,509 G756W probably damaging Het
Mroh2b G T 15: 4,914,133 E384* probably null Het
Nol10 G A 12: 17,369,620 probably null Het
Nxpe5 T C 5: 138,239,241 L9P probably damaging Het
Olfr457 A G 6: 42,471,902 I92T probably damaging Het
Olfr617 C T 7: 103,584,828 R269C probably benign Het
Olfr857 A G 9: 19,713,037 D70G probably damaging Het
Pak2 T C 16: 32,044,488 E94G probably damaging Het
Pcdha7 A G 18: 36,974,671 K250E possibly damaging Het
Pde8b T C 13: 95,041,990 T541A probably damaging Het
Peg3 A T 7: 6,709,970 I751N probably damaging Het
Prpsap2 T C 11: 61,731,570 D269G probably damaging Het
Raver2 C A 4: 101,102,692 T123K possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Scn2b A G 9: 45,125,518 Y108C probably damaging Het
Sdr16c6 T C 4: 4,069,923 E139G probably damaging Het
Sgpp2 A G 1: 78,360,188 I68V probably benign Het
Sorbs2 T A 8: 45,796,013 I687N probably damaging Het
Sorcs3 G A 19: 48,796,472 probably null Het
Stk16 T A 1: 75,212,965 C174S probably benign Het
Ttll9 C A 2: 152,991,652 N198K possibly damaging Het
Unc13c A T 9: 73,930,823 D915E probably benign Het
Unc5b T A 10: 60,778,267 K268* probably null Het
Vim T A 2: 13,580,013 probably null Het
Xirp2 T A 2: 67,513,461 N2015K probably damaging Het
Zfp160 T G 17: 21,020,733 M21R possibly damaging Het
Other mutations in Klhl42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Klhl42 APN 6 147101733 missense probably damaging 1.00
IGL01401:Klhl42 APN 6 147107743 missense probably benign 0.03
IGL02590:Klhl42 APN 6 147092312 missense probably damaging 0.97
R0045:Klhl42 UTSW 6 147092168 missense probably benign
R1066:Klhl42 UTSW 6 147107899 missense probably benign
R1920:Klhl42 UTSW 6 147107929 missense probably damaging 1.00
R1951:Klhl42 UTSW 6 147091823 missense probably damaging 0.99
R2017:Klhl42 UTSW 6 147107793 missense probably benign 0.04
R2021:Klhl42 UTSW 6 147091896 missense possibly damaging 0.59
R2065:Klhl42 UTSW 6 147101663 missense probably damaging 1.00
R2128:Klhl42 UTSW 6 147101753 missense probably benign 0.00
R2982:Klhl42 UTSW 6 147091616 missense probably damaging 1.00
R3415:Klhl42 UTSW 6 147107880 missense probably damaging 1.00
R3416:Klhl42 UTSW 6 147107880 missense probably damaging 1.00
R3417:Klhl42 UTSW 6 147107880 missense probably damaging 1.00
R4450:Klhl42 UTSW 6 147091671 missense probably benign 0.16
R4967:Klhl42 UTSW 6 147108004 missense possibly damaging 0.77
R5556:Klhl42 UTSW 6 147108112 missense probably benign 0.00
R6269:Klhl42 UTSW 6 147092307 missense probably damaging 1.00
R7375:Klhl42 UTSW 6 147092040 missense probably benign
R7769:Klhl42 UTSW 6 147091860 missense possibly damaging 0.95
R7848:Klhl42 UTSW 6 147108100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATTCCCGCTACTGTTG -3'
(R):5'- TTCTTCCTAGCAAGCCCTGG -3'

Sequencing Primer
(F):5'- GGGACTGCAGCCTGAAG -3'
(R):5'- TGGGCTCCCTGGGAACTC -3'
Posted On2016-08-04