Incidental Mutation 'R5342:Olfr617'
ID 422385
Institutional Source Beutler Lab
Gene Symbol Olfr617
Ensembl Gene ENSMUSG00000073946
Gene Name olfactory receptor 617
Synonyms GA_x6K02T2PBJ9-6306819-6307775, MOR31-10
MMRRC Submission 042921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R5342 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103573061-103586795 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103584828 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 269 (R269C)
Ref Sequence ENSEMBL: ENSMUSP00000149045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048265] [ENSMUST00000215755] [ENSMUST00000216516]
AlphaFold Q8VGA1
Predicted Effect probably benign
Transcript: ENSMUST00000048265
AA Change: R269C

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040319
Gene: ENSMUSG00000073946
AA Change: R269C

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 8.5e-109 PFAM
Pfam:7TM_GPCR_Srsx 41 225 2.3e-10 PFAM
Pfam:7tm_1 47 299 4.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179692
Predicted Effect probably benign
Transcript: ENSMUST00000215755
AA Change: R269C

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000216516
AA Change: R269C

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 A C 8: 27,226,781 Y392* probably null Het
Arap1 G A 7: 101,404,960 E1330K probably benign Het
Atg2b G T 12: 105,658,916 D600E possibly damaging Het
Atp1b2 C T 11: 69,602,828 V142I probably damaging Het
AW551984 A T 9: 39,594,551 M450K probably damaging Het
BC067074 T C 13: 113,366,269 probably null Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Ccnt2 T C 1: 127,791,733 silent Het
Cdca7l A G 12: 117,877,033 Y430C probably damaging Het
Ces4a A G 8: 105,146,143 T343A probably benign Het
Clec2g C T 6: 128,948,751 A41V probably benign Het
Crybg3 A T 16: 59,522,149 Y2708N probably damaging Het
Dmxl1 A T 18: 49,951,235 E2758V probably damaging Het
Dusp27 T C 1: 166,110,250 E80G probably benign Het
Eci2 C T 13: 34,978,724 E283K probably benign Het
Edrf1 T A 7: 133,651,910 probably null Het
Eif3b T C 5: 140,425,280 L162P probably damaging Het
Ercc3 A G 18: 32,245,595 I210V probably benign Het
Exoc1 A G 5: 76,567,014 N739S probably damaging Het
Gm7334 A G 17: 50,698,754 K23E probably benign Het
Gm7356 T G 17: 14,001,098 D223A possibly damaging Het
Klhl26 A G 8: 70,455,565 L47P probably damaging Het
Klhl42 C T 6: 147,092,286 T252I possibly damaging Het
Morc1 G T 16: 48,618,509 G756W probably damaging Het
Mroh2b G T 15: 4,914,133 E384* probably null Het
Nol10 G A 12: 17,369,620 probably null Het
Nxpe5 T C 5: 138,239,241 L9P probably damaging Het
Olfr457 A G 6: 42,471,902 I92T probably damaging Het
Olfr857 A G 9: 19,713,037 D70G probably damaging Het
Pak2 T C 16: 32,044,488 E94G probably damaging Het
Pcdha7 A G 18: 36,974,671 K250E possibly damaging Het
Pde8b T C 13: 95,041,990 T541A probably damaging Het
Peg3 A T 7: 6,709,970 I751N probably damaging Het
Prpsap2 T C 11: 61,731,570 D269G probably damaging Het
Raver2 C A 4: 101,102,692 T123K possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Scn2b A G 9: 45,125,518 Y108C probably damaging Het
Sdr16c6 T C 4: 4,069,923 E139G probably damaging Het
Sgpp2 A G 1: 78,360,188 I68V probably benign Het
Sorbs2 T A 8: 45,796,013 I687N probably damaging Het
Sorcs3 G A 19: 48,796,472 probably null Het
Stk16 T A 1: 75,212,965 C174S probably benign Het
Ttll9 C A 2: 152,991,652 N198K possibly damaging Het
Unc13c A T 9: 73,930,823 D915E probably benign Het
Unc5b T A 10: 60,778,267 K268* probably null Het
Vim T A 2: 13,580,013 probably null Het
Xirp2 T A 2: 67,513,461 N2015K probably damaging Het
Zfp160 T G 17: 21,020,733 M21R possibly damaging Het
Other mutations in Olfr617
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Olfr617 APN 7 103584693 missense probably damaging 1.00
IGL01355:Olfr617 APN 7 103584373 missense probably damaging 1.00
IGL01411:Olfr617 APN 7 103584117 missense probably damaging 1.00
IGL01412:Olfr617 APN 7 103584907 missense probably damaging 1.00
IGL02379:Olfr617 APN 7 103584892 missense possibly damaging 0.84
ANU23:Olfr617 UTSW 7 103584693 missense probably damaging 1.00
IGL03054:Olfr617 UTSW 7 103584840 missense probably benign 0.23
R0536:Olfr617 UTSW 7 103584261 missense probably damaging 1.00
R4222:Olfr617 UTSW 7 103584759 missense probably damaging 1.00
R4224:Olfr617 UTSW 7 103584759 missense probably damaging 1.00
R5587:Olfr617 UTSW 7 103584531 missense probably benign 0.07
R5607:Olfr617 UTSW 7 103584299 nonsense probably null
R5608:Olfr617 UTSW 7 103584299 nonsense probably null
R6904:Olfr617 UTSW 7 103584520 missense possibly damaging 0.83
R6929:Olfr617 UTSW 7 103584444 missense probably damaging 0.98
R7399:Olfr617 UTSW 7 103584381 missense possibly damaging 0.78
R7607:Olfr617 UTSW 7 103584930 missense probably damaging 0.97
R7771:Olfr617 UTSW 7 103584090 missense probably benign 0.33
Z1177:Olfr617 UTSW 7 103584699 missense probably benign 0.41
Z1177:Olfr617 UTSW 7 103584947 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCCTAGATGCAGTGCTG -3'
(R):5'- TGCCCTCAGAAATAATGACTTGC -3'

Sequencing Primer
(F):5'- CCTAGATGCAGTGCTGATCATTGTC -3'
(R):5'- CCTCAGAAATAATGACTTGCTTTAAC -3'
Posted On 2016-08-04