Incidental Mutation 'R5342:Edrf1'
ID 422386
Institutional Source Beutler Lab
Gene Symbol Edrf1
Ensembl Gene ENSMUSG00000039990
Gene Name erythroid differentiation regulatory factor 1
Synonyms 2700050L05Rik
MMRRC Submission 042921-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock # R5342 (G1)
Quality Score 171
Status Not validated
Chromosome 7
Chromosomal Location 133637543-133672971 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 133651910 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051169] [ENSMUST00000128901]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000051169
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128901
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211072
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in erythroid cell differentiation. The encoded protein inhibits DNA binding of the erythroid transcription factor GATA-1 and may regulate the expression of alpha-globin and gamma-globin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 A C 8: 27,226,781 Y392* probably null Het
Arap1 G A 7: 101,404,960 E1330K probably benign Het
Atg2b G T 12: 105,658,916 D600E possibly damaging Het
Atp1b2 C T 11: 69,602,828 V142I probably damaging Het
AW551984 A T 9: 39,594,551 M450K probably damaging Het
BC067074 T C 13: 113,366,269 probably null Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Ccnt2 T C 1: 127,791,733 silent Het
Cdca7l A G 12: 117,877,033 Y430C probably damaging Het
Ces4a A G 8: 105,146,143 T343A probably benign Het
Clec2g C T 6: 128,948,751 A41V probably benign Het
Crybg3 A T 16: 59,522,149 Y2708N probably damaging Het
Dmxl1 A T 18: 49,951,235 E2758V probably damaging Het
Dusp27 T C 1: 166,110,250 E80G probably benign Het
Eci2 C T 13: 34,978,724 E283K probably benign Het
Eif3b T C 5: 140,425,280 L162P probably damaging Het
Ercc3 A G 18: 32,245,595 I210V probably benign Het
Exoc1 A G 5: 76,567,014 N739S probably damaging Het
Gm7334 A G 17: 50,698,754 K23E probably benign Het
Gm7356 T G 17: 14,001,098 D223A possibly damaging Het
Klhl26 A G 8: 70,455,565 L47P probably damaging Het
Klhl42 C T 6: 147,092,286 T252I possibly damaging Het
Morc1 G T 16: 48,618,509 G756W probably damaging Het
Mroh2b G T 15: 4,914,133 E384* probably null Het
Nol10 G A 12: 17,369,620 probably null Het
Nxpe5 T C 5: 138,239,241 L9P probably damaging Het
Olfr457 A G 6: 42,471,902 I92T probably damaging Het
Olfr617 C T 7: 103,584,828 R269C probably benign Het
Olfr857 A G 9: 19,713,037 D70G probably damaging Het
Pak2 T C 16: 32,044,488 E94G probably damaging Het
Pcdha7 A G 18: 36,974,671 K250E possibly damaging Het
Pde8b T C 13: 95,041,990 T541A probably damaging Het
Peg3 A T 7: 6,709,970 I751N probably damaging Het
Prpsap2 T C 11: 61,731,570 D269G probably damaging Het
Raver2 C A 4: 101,102,692 T123K possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Scn2b A G 9: 45,125,518 Y108C probably damaging Het
Sdr16c6 T C 4: 4,069,923 E139G probably damaging Het
Sgpp2 A G 1: 78,360,188 I68V probably benign Het
Sorbs2 T A 8: 45,796,013 I687N probably damaging Het
Sorcs3 G A 19: 48,796,472 probably null Het
Stk16 T A 1: 75,212,965 C174S probably benign Het
Ttll9 C A 2: 152,991,652 N198K possibly damaging Het
Unc13c A T 9: 73,930,823 D915E probably benign Het
Unc5b T A 10: 60,778,267 K268* probably null Het
Vim T A 2: 13,580,013 probably null Het
Xirp2 T A 2: 67,513,461 N2015K probably damaging Het
Zfp160 T G 17: 21,020,733 M21R possibly damaging Het
Other mutations in Edrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Edrf1 APN 7 133658553 nonsense probably null
IGL01637:Edrf1 APN 7 133650525 missense probably damaging 1.00
IGL01697:Edrf1 APN 7 133643730 missense probably benign 0.02
IGL01893:Edrf1 APN 7 133657102 missense probably benign 0.09
IGL02202:Edrf1 APN 7 133656970 missense probably benign 0.00
IGL02278:Edrf1 APN 7 133657000 missense probably benign 0.00
IGL02382:Edrf1 APN 7 133650615 splice site probably benign
IGL02743:Edrf1 APN 7 133656491 unclassified probably benign
R0265:Edrf1 UTSW 7 133657045 missense probably damaging 1.00
R0282:Edrf1 UTSW 7 133644022 missense probably benign 0.21
R1167:Edrf1 UTSW 7 133644066 missense probably benign 0.08
R1633:Edrf1 UTSW 7 133652140 missense probably damaging 1.00
R2039:Edrf1 UTSW 7 133653949 nonsense probably null
R2060:Edrf1 UTSW 7 133657129 nonsense probably null
R2920:Edrf1 UTSW 7 133667572 missense probably benign 0.00
R4770:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4887:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R4888:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5135:Edrf1 UTSW 7 133651044 missense probably benign 0.03
R5156:Edrf1 UTSW 7 133660179 missense probably damaging 1.00
R5290:Edrf1 UTSW 7 133650566 missense probably damaging 0.98
R5416:Edrf1 UTSW 7 133641402 missense possibly damaging 0.52
R5450:Edrf1 UTSW 7 133658610 missense probably damaging 0.99
R5906:Edrf1 UTSW 7 133663415 missense probably benign
R6272:Edrf1 UTSW 7 133637808 start gained probably benign
R6275:Edrf1 UTSW 7 133667582 missense possibly damaging 0.60
R7144:Edrf1 UTSW 7 133637849 missense probably benign
R7244:Edrf1 UTSW 7 133654350 missense probably benign 0.01
R7716:Edrf1 UTSW 7 133643726 missense probably damaging 0.99
R8193:Edrf1 UTSW 7 133661877 missense possibly damaging 0.95
R8197:Edrf1 UTSW 7 133647359 missense probably benign 0.41
R8553:Edrf1 UTSW 7 133650318 missense possibly damaging 0.88
R8710:Edrf1 UTSW 7 133643766 missense probably damaging 1.00
R8839:Edrf1 UTSW 7 133653915 missense probably benign 0.00
R9035:Edrf1 UTSW 7 133643702 missense probably damaging 0.97
R9051:Edrf1 UTSW 7 133671478 missense probably benign 0.00
R9121:Edrf1 UTSW 7 133657041 frame shift probably null
R9396:Edrf1 UTSW 7 133660109 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACGAAAGCTTGTCTGCAGTG -3'
(R):5'- TGTCATCTGCTGGGTCAGAG -3'

Sequencing Primer
(F):5'- TGCAGTGGCGGAGGAGG -3'
(R):5'- GGTGCTGTAGGATCCATTCTCATC -3'
Posted On 2016-08-04