Mutagenetix > Incidental Mutation

Incidental Mutation 'R5343:F13b'

422423

Institutional Source

Beutler Lab

Gene Symbol

F13b

Ensembl Gene

ENSMUSG00000026368

Gene Name

coagulation factor XIII, beta subunit

Synonyms

Cf-13b, Cf13b

MMRRC Submission

042922-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5343 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139501702-139523752 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139510544 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 299 (V299A)

Ref Sequence

ENSEMBL: ENSMUSP00000027615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027615]

AlphaFold

Q07968

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027615
AA Change: V299A

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000027615
Gene: ENSMUSG00000026368
AA Change: V299A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CCP	26	88	1.26e-7	SMART
CCP	92	147	2.11e-9	SMART
CCP	154	209	9.83e-10	SMART
CCP	214	268	7.62e-16	SMART
CCP	275	328	8.62e-15	SMART
CCP	337	390	4.62e-15	SMART
CCP	397	451	3.5e-15	SMART
Blast:CCP	455	516	1e-28	BLAST
CCP	525	579	2.44e-14	SMART
Blast:CCP	583	647	1e-8	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes subunit B of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit A to form a heterotetrameric protein that circulates in the plasma. During the blood coagulation process, thrombin-mediated proteolytic cleavage of the subunit A results in the dissociation of the encoded protein from the heterotetramer. Male mice lacking the encoded protein exhibit mild fibrosis together with hemosiderin deposits in the heart. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display increased bleeding time. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310039H08Rik	C	A	17: 46,773,036	A75E	probably damaging	Het
5730559C18Rik	G	T	1: 136,225,442	H237Q	probably benign	Het
Adck5	G	A	15: 76,595,580	R560H	probably damaging	Het
Ahctf1	A	T	1: 179,770,634	Y964*	probably null	Het
Alg8	T	C	7: 97,386,919	I339T	possibly damaging	Het
Alox5	T	C	6: 116,413,507	D503G	possibly damaging	Het
Camk4	A	G	18: 33,078,069	T76A	probably damaging	Het
Cdh3	T	C	8: 106,552,936	V728A	probably benign	Het
Chd4	T	A	6: 125,120,363	N1326K	probably damaging	Het
Cnn1	A	T	9: 22,105,410	Y48F	probably benign	Het
Dnah6	T	A	6: 73,212,616	E16D	probably benign	Het
Ezh2	A	G	6: 47,576,615	L56S	probably damaging	Het
Hydin	T	C	8: 110,485,419	S1279P	probably benign	Het
Ift172	T	C	5: 31,263,812	M981V	probably benign	Het
Lpl	T	A	8: 68,895,737	V206E	probably damaging	Het
Mre11a	A	G	9: 14,811,834	D368G	probably damaging	Het
Mreg	G	A	1: 72,160,958	P191L	probably damaging	Het
Mtif2	G	T	11: 29,536,964	A134S	probably damaging	Het
Mxd4	T	C	5: 34,177,730	S114G	probably benign	Het
Myo1b	T	C	1: 51,778,537	Q522R	probably benign	Het
Ncapd3	GGCTGCTGCTGCTGCTGCTGCTG	GGCTGCTGCTGCTGCTGCTG	9: 27,088,053		probably benign	Het
Ninl	T	C	2: 150,971,190	E182G	probably benign	Het
Notch3	T	C	17: 32,143,283	N1456S	probably benign	Het
Npr1	G	T	3: 90,458,208	N648K	possibly damaging	Het
Oas3	A	G	5: 120,756,238	S1016P	possibly damaging	Het
Olfr1499	T	C	19: 13,814,960	N210S	probably damaging	Het
Olfr518	C	T	7: 108,880,998	V203M	possibly damaging	Het
Palld	A	G	8: 61,549,815		probably benign	Het
Patj	T	G	4: 98,676,193	I1021S	probably damaging	Het
Pfpl	T	A	19: 12,428,688	L101Q	probably damaging	Het
Pilrb2	T	A	5: 137,870,966	E124V	possibly damaging	Het
Pomk	A	G	8: 25,983,016	F303S	probably benign	Het
Rap1gap2	A	T	11: 74,441,785	S65T	probably damaging	Het
Sema3a	G	A	5: 13,473,406	C114Y	probably damaging	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Spry4	A	T	18: 38,589,975	V245E	probably damaging	Het
Srrt	T	C	5: 137,297,165	Y271C	probably damaging	Het
Tas2r136	A	G	6: 132,778,080	V28A	probably benign	Het
Tenm2	A	G	11: 36,069,503	V998A	probably benign	Het
Trim37	A	G	11: 87,137,603	E46G	probably damaging	Het
Ubiad1	A	G	4: 148,436,435	V244A	possibly damaging	Het

Other mutations in F13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:F13b	APN	1	139510587	missense	probably benign	0.01
IGL00937:F13b	APN	1	139517360	splice site	probably benign
IGL01138:F13b	APN	1	139517212	missense	probably damaging	0.99
IGL01319:F13b	APN	1	139506793	missense	probably damaging	0.98
IGL01328:F13b	APN	1	139508082	splice site	probably benign
IGL01621:F13b	APN	1	139503851	missense	probably benign	0.00
IGL01843:F13b	APN	1	139516427	missense	probably damaging	1.00
IGL02153:F13b	APN	1	139516377	missense	probably damaging	1.00
IGL02192:F13b	APN	1	139517333	missense	probably damaging	1.00
IGL02555:F13b	APN	1	139517186	missense	probably damaging	1.00
IGL03036:F13b	APN	1	139508115	missense	possibly damaging	0.80
IGL03185:F13b	APN	1	139516386	missense	probably benign	0.03
IGL03303:F13b	APN	1	139513036	missense	possibly damaging	0.67
IGL03335:F13b	APN	1	139522386	missense	probably damaging	1.00
IGL03371:F13b	APN	1	139506936	missense	probably damaging	1.00
R0139:F13b	UTSW	1	139508203	missense	probably damaging	0.96
R0157:F13b	UTSW	1	139503847	missense	probably benign
R0381:F13b	UTSW	1	139510859	missense	probably damaging	0.98
R0492:F13b	UTSW	1	139522559	splice site	probably null
R0589:F13b	UTSW	1	139506933	missense	possibly damaging	0.94
R1462:F13b	UTSW	1	139507636	missense	probably damaging	1.00
R1462:F13b	UTSW	1	139507636	missense	probably damaging	1.00
R1515:F13b	UTSW	1	139510965	missense	probably damaging	1.00
R1869:F13b	UTSW	1	139510934	missense	probably benign	0.44
R2047:F13b	UTSW	1	139508223	missense	probably damaging	1.00
R2218:F13b	UTSW	1	139506844	missense	probably benign	0.42
R2878:F13b	UTSW	1	139501747	start codon destroyed	probably null
R3032:F13b	UTSW	1	139517333	missense	probably damaging	1.00
R4077:F13b	UTSW	1	139501770	missense	unknown
R4079:F13b	UTSW	1	139501770	missense	unknown
R4208:F13b	UTSW	1	139516341	missense	probably damaging	1.00
R4350:F13b	UTSW	1	139516298	missense	probably benign	0.00
R4674:F13b	UTSW	1	139501804	missense	unknown
R4675:F13b	UTSW	1	139501804	missense	unknown
R4972:F13b	UTSW	1	139510923	missense	probably damaging	1.00
R5212:F13b	UTSW	1	139512987	missense	probably benign
R5503:F13b	UTSW	1	139522543	missense	probably benign	0.00
R5984:F13b	UTSW	1	139508212	missense	probably damaging	1.00
R7012:F13b	UTSW	1	139516358	missense	probably benign
R7155:F13b	UTSW	1	139508157	missense	probably damaging	1.00
R7250:F13b	UTSW	1	139516489	critical splice donor site	probably null
R7478:F13b	UTSW	1	139507695	missense	probably benign	0.01
R7779:F13b	UTSW	1	139516386	missense	probably benign	0.03
R7960:F13b	UTSW	1	139503771	nonsense	probably null
R8007:F13b	UTSW	1	139506942	missense	probably benign	0.11
R8043:F13b	UTSW	1	139522448	missense	probably benign
R8281:F13b	UTSW	1	139510951	missense	probably benign	0.03
R9034:F13b	UTSW	1	139508223	missense	probably damaging	1.00
Z1088:F13b	UTSW	1	139508202	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- GCACGGATGTTTCTGCAGTC -3'
(R):5'- CAAGGACAACAATAAACATGTCTGG -3'

Sequencing Primer
(F):5'- CTGCAGTCGATGGTGCTTAAC -3'
(R):5'- CAATAAACATGTCTGGAAATGTCAC -3'

Posted On

2016-08-04